About Me
Software developer without a CS background. Looking to expand my knowledge of fundamentals and bridge my experience to more formal concepts.
Classes
|
Class status: Established
Role:
Student
|
.
88% complete
|
Submitted Assignments
 |
MIT OpenCourseWare 6.00 Introduction to Computer Science and Programming: Lesson 19, HW 1
Designed my robot classes so RandomWalkRobot could inherit from Robot rather than BaseRobot, and avoid duplicate code in updatePositionAndClean
# Problem Set 11: Simulating robots
# Name:
# Collaborators:
# Time:
import math
import random
import ps11_visualize
import pylab
# === Provided classes
class Position(object):
"""
A Position represents a location in a two-dimensional room.
"""
def __init__(self, x, y):
"""
Initializes a position with coordinates (x, y).
x: a real number indicating the x-coordinate
y: a real number indicating the y-coordinate
"""
self.x = x
self.y = y
def getX(self):
return self.x
def getY(self):
return self.y
def getNewPosition(self, angle, speed):
"""
Computes and returns the new Position after a single clock-tick has
passed, with this object as the current position, and with the
specified angle and speed.
Does NOT test whether the returned position fits inside the room.
angle: integer representing angle in degrees, 0 <= angle < 360
speed: positive float representing speed
Returns: a Position object representing the new position.
"""
old_x, old_y = self.getX(), self.getY()
# Compute the change in position
delta_y = speed * math.cos(math.radians(angle))
delta_x = speed * math.sin(math.radians(angle))
# Add that to the existing position
new_x = old_x + delta_x
new_y = old_y + delta_y
return Position(new_x, new_y)
# === Problems 1 and 2
class RectangularRoom(object):
"""
A RectangularRoom represents a rectangular region containing clean or dirty
tiles.
A room has a width and a height and contains (width * height) tiles. At any
particular time, each of these tiles is either clean or dirty.
"""
def __init__(self, width, height):
"""
Initializes a rectangular room with the specified width and height.
Initially, no tiles in the room have been cleaned.
width: an integer > 0
height: an integer > 0
"""
if width < 0: raise ValueException('Width cannot be less than 0')
if height < 0: raise ValueException('Height cannot be less than 0')
self.width = width
self.height = height
self.cleanedTiles = []
def cleanTileAtPosition(self, pos):
"""
Mark the tile under the position POS as cleaned.
Assumes that POS represents a valid position inside this room.
pos: a Position
"""
coords = int(pos.getX()), int(pos.getY())
if coords in self.cleanedTiles:
return
self.cleanedTiles.append(coords)
def isTileCleaned(self, m, n):
"""
Return True if the tile (m, n) has been cleaned.
Assumes that (m, n) represents a valid tile inside the room.
m: an integer
n: an integer
returns: True if (m, n) is cleaned, False otherwise
"""
return (int(m), int(n)) in self.cleanedTiles
def getNumTiles(self):
"""
Return the total number of tiles in the room.
returns: an integer
"""
return self.width * self.height
def getNumCleanedTiles(self):
"""
Return the total number of clean tiles in the room.
returns: an integer
"""
return len(self.cleanedTiles)
def getRandomPosition(self):
"""
Return a random position inside the room.
returns: a Position object.
"""
return Position(random.randrange(0, self.width), random.randrange(0, self.height))
def isPositionInRoom(self, pos):
"""
Return True if POS is inside the room.
pos: a Position object.
returns: True if POS is in the room, False otherwise.
"""
return 0 <= pos.getX() <= self.width and 0 <= pos.getY() <= self.height
class BaseRobot(object):
"""
Represents a robot cleaning a particular room.
At all times the robot has a particular position and direction in
the room. The robot also has a fixed speed.
Subclasses of BaseRobot should provide movement strategies by
implementing updatePositionAndClean(), which simulates a single
time-step.
"""
def __init__(self, room, speed):
"""
Initializes a Robot with the given speed in the specified
room. The robot initially has a random direction d and a
random position p in the room.
The direction d is an integer satisfying 0 <= d < 360; it
specifies an angle in degrees.
p is a Position object giving the robot's position.
room: a RectangularRoom object.
speed: a float (speed > 0)
"""
self.room = room
self.speed = speed
self.direction = random.randrange(0, 360)
self.position = room.getRandomPosition()
def getRobotPosition(self):
"""
Return the position of the robot.
returns: a Position object giving the robot's position.
"""
return self.position
def getRobotDirection(self):
"""
Return the direction of the robot.
returns: an integer d giving the direction of the robot as an angle in
degrees, 0 <= d < 360.
"""
return self.direction
def setRobotPosition(self, position):
"""
Set the position of the robot to POSITION.
position: a Position object.
"""
self.position = position
def setRobotDirection(self, direction):
"""
Set the direction of the robot to DIRECTION.
direction: integer representing an angle in degrees
"""
self.direction = direction
class Robot(BaseRobot):
"""
A Robot is a BaseRobot with the standard movement strategy.
At each time-step, a Robot attempts to move in its current
direction; when it hits a wall, it chooses a new direction
randomly.
"""
def updatePositionAndClean(self):
"""
Simulate the passage of a single time-step.
Move the robot to a new position and mark the tile it is on as having
been cleaned.
"""
newPosition = self.position.getNewPosition(self.direction, self.speed)
while not self.room.isPositionInRoom(newPosition):
self.direction = random.randrange(0, 360)
newPosition = self.position.getNewPosition(self.direction, self.speed)
self.room.cleanTileAtPosition(newPosition)
self.position = newPosition
# === Problem 3
def runSimulation(num_robots, speed, width, height, minCoverage, numTrials,
robotType, visualize = False):
"""
Runs NUM_TRIALS trials of the simulation and returns a list of
lists, one per trial. The list for a trial has an element for each
timestep of that trial, the value of which is the percentage of
the room that is clean after that timestep. Each trial stops when
MIN_COVERAGE of the room is clean.
The simulation is run with NUM_ROBOTS robots of type ROBOT_TYPE,
each with speed SPEED, in a room of dimensions WIDTH x HEIGHT.
Visualization is turned on when boolean VISUALIZE is set to True.
num_robots: an int (num_robots > 0)
speed: a float (speed > 0)
width: an int (width > 0)
height: an int (height > 0)
minCoverage: a float (0 <= minCoverage <= 1.0)
num_trials: an int (num_trials > 0)
robotType: class of robot to be instantiated (e.g. Robot or
RandomWalkRobot)
visualize: a boolean (True to turn on visualization)
"""
def percentageOfRoomCleaned(room):
return float(room.getNumCleanedTiles()) / room.getNumTiles()
results = []
for trialNum in range(1, numTrials + 1):
if visualize:
anim = ps11_visualize.RobotVisualization(num_robots, width, height)
trialResults = []
room = RectangularRoom(width, height)
robots = []
for robotNum in range(0, num_robots):
robots.append(robotType(room, speed))
while percentageOfRoomCleaned(room) < minCoverage:
if visualize:
anim.update(room, robots)
trialResults.append(percentageOfRoomCleaned(room))
for robo in robots:
robo.updatePositionAndClean()
if visualize:
anim.done()
results.append(trialResults)
return results
#print(runSimulation(1, 1, 15, 15, 1.0, 100, Robot, True))
# === Provided function
def computeMeans(list_of_lists):
"""
Returns a list as long as the longest list in LIST_OF_LISTS, where
the value at index i is the average of the values at index i in
all of LIST_OF_LISTS' lists.
Lists shorter than the longest list are padded with their final
value to be the same length.
"""
# Find length of longest list
longest = 0
for lst in list_of_lists:
if len(lst) > longest:
longest = len(lst)
# Get totals
tots = [0]*(longest)
for lst in list_of_lists:
for i in range(longest):
if i < len(lst):
tots[i] += lst[i]
else:
tots[i] += lst[-1]
# Convert tots to an array to make averaging across each index easier
tots = pylab.array(tots)
# Compute means
means = tots/float(len(list_of_lists))
return means
def computeAverageTime(listOfLists):
totalTime = 0
for l in listOfLists:
totalTime += len(l)
return float(totalTime) / len(listOfLists)
# === Problem 4
def showPlot1():
"""
Produces a plot showing dependence of cleaning time on room size.
"""
numTrials = 50
averageTimes = []
roomSideSizes = (5, 10, 15, 20, 25)
roomAreas = []
for size in roomSideSizes:
roomAreas.append(size**2)
averageTimes.append(computeAverageTime(runSimulation(1, 1.0, size, size, .75, numTrials, Robot)))
pylab.figure()
pylab.plot(roomAreas, averageTimes)
pylab.ylabel('Timesteps')
pylab.xlabel('Room area')
pylab.title('Time to clean 75%% of a square room with 1 robot (%d trials)' % numTrials)
def showPlot2():
"""
Produces a plot showing dependence of cleaning time on number of robots.
"""
numTrials = 50
averageTimes = []
for numRobots in range(1, 11):
averageTimes.append(computeAverageTime(runSimulation(numRobots, 1.0, 25, 25, .75, numTrials, Robot)))
pylab.figure()
pylab.plot(range(1, 11), averageTimes)
pylab.ylabel('Timesteps')
pylab.xlabel('Number of robots')
pylab.title('Time to clean 75%% of a 25x25 room (%d trials)' % numTrials)
def showPlot3():
"""
Produces a plot showing dependence of cleaning time on room shape.
"""
numTrials = 50
averageTimes = []
widthHeightRatios = []
for width, height in ((20, 20), (25, 16), (40, 10), (50, 8), (80, 5), (100, 4)):
widthHeightRatios.append(float(width) / height)
averageTimes.append(computeAverageTime(runSimulation(2, 1.0, width, height, .75, numTrials, Robot)))
pylab.figure()
pylab.plot(widthHeightRatios, averageTimes)
pylab.ylabel('Timesteps')
pylab.xlabel('Width to height ratio for room size')
pylab.title('Time to clean 75%% of a room with the same area, but varying widths/heights using 2 robots (%d trials)' % numTrials)
def showPlot4():
"""
Produces a plot showing cleaning time vs. percentage cleaned, for
each of 1-5 robots.
"""
numTrials = 15
pylab.figure()
labels = []
for numRobots in range(1, 6):
label = "%d robot(s)" % numRobots
labels.append(label)
results = computeMeans(runSimulation(numRobots, 1.0, 25, 25, 1, numTrials, Robot))
pylab.plot(results * 100, range(0, len(results)), label=label)
pylab.legend(labels)
pylab.ylabel('Timesteps')
pylab.xlabel('Minimum coverage %')
pylab.title('Time to clean vs Minimum coverage %% with 1-5 robots (%d trials)' % numTrials)
#showPlot1()
#showPlot2()
#showPlot3()
#showPlot4()
#pylab.show()
# === Problem 5
class RandomWalkRobot(Robot):
"""
A RandomWalkRobot is a robot with the "random walk" movement
strategy: it chooses a new direction at random after each
time-step.
"""
def updatePositionAndClean(self):
self.direction = random.randrange(0, 360)
Robot.updatePositionAndClean(self)
#runSimulation(1, 1.0, 25, 25, 1, 1, RandomWalkRobot, True)
# === Problem 6
def showPlot5():
"""
Produces a plot comparing the two robot strategies.
"""
numTrials = 10
pylab.figure()
labels = []
robotTypes = (Robot, RandomWalkRobot)
for numRobots in range(1, 3):
for robotType in robotTypes:
label = "%d %s robot(s)" % (numRobots, robotType.__name__)
labels.append(label)
results = computeMeans(runSimulation(numRobots, 1.0, 25, 25, 1, numTrials, robotType))
pylab.plot(results * 100, range(0, len(results)), label=label)
pylab.legend(labels)
pylab.ylabel('Timesteps')
pylab.xlabel('Minimum coverage %')
pylab.title('Time to clean vs Minimum coverage %% with 1-5 robots of type Robot and RandomWalkRobot (%d trials)' % numTrials)
showPlot5()
pylab.show()
rfh
1 year ago
|
 |
MIT OpenCourseWare 6.00 Introduction to Computer Science and Programming: Lesson 18, HW 1
# Backend code for PS10
import random
import string
# Global Constants
VOWELS = 'aeiou'
CONSONANTS = 'bcdfghjklmnpqrstvwxyz'
HAND_SIZE = 30
SCRABBLE_LETTER_VALUES = {
'a': 1, 'b': 3, 'c': 3, 'd': 2, 'e': 1, 'f': 4, 'g': 2, 'h': 4, 'i': 1,
'j': 8, 'k': 5, 'l': 1, 'm': 3, 'n': 1, 'o': 1, 'p': 3, 'q': 10, 'r': 1,
's': 1, 't': 1, 'u': 1, 'v': 4, 'w': 4, 'x': 8, 'y': 4, 'z': 10
}
HUMAN_SOLO = 0
HUMAN_VS_HUMAN = 1
HUMAN_VS_COMP = 2
WORDLIST_FILENAME = "words.txt"
def getFrequencyDict(sequence):
"""
Given a sequence of letters, convert the sequence to a dictionary of
letters -> frequencies. Used by containsLetters().
returns: dictionary of letters -> frequencies
"""
freq = {}
for x in sequence:
freq[x] = freq.get(x,0) + 1
return freq
def getWordScore(word):
"""
Computes the score of a word (no bingo bonus is added).
word: The word to score (a string).
returns: score of the word.
"""
score = 0
for ch in word:
score += SCRABBLE_LETTER_VALUES[ch]
if len(word) == HAND_SIZE:
score += 50
return score
#
# Problem 2: Representing a Hand
#
class Hand(object):
def __init__(self, handSize, initialHandDict = None):
"""
Initialize a hand.
handSize: The size of the hand
postcondition: initializes a hand with random set of initial letters.
"""
num_vowels = handSize / 3
if initialHandDict is None:
initialHandDict = {}
for i in range(num_vowels):
x = VOWELS[random.randrange(0,len(VOWELS))]
initialHandDict[x] = initialHandDict.get(x, 0) + 1
for i in range(num_vowels, handSize):
x = CONSONANTS[random.randrange(0,len(CONSONANTS))]
initialHandDict[x] = initialHandDict.get(x, 0) + 1
self.initialSize = handSize
for letter, frequency in initialHandDict.items():
if frequency < 1:
del initialHandDict[letter]
self.handDict = initialHandDict
def update(self, word):
"""
Remove letters in word from this hand.
word: The word (a string) to remove from the hand
postcondition: Letters in word are removed from this hand
"""
for letter, frequency in getFrequencyDict(word).items():
self.handDict[letter] = self.handDict[letter] - frequency
if 0 == self.handDict[letter]:
del self.handDict[letter]
def containsLetters(self, letters):
"""
Test if this hand contains the characters required to make the input
string (letters)
returns: True if the hand contains the characters to make up letters,
False otherwise
"""
for letter, frequency in getFrequencyDict(letters).items():
if self.handDict.get(letter, 0) < frequency:
return False
return True
def isEmpty(self):
"""
Test if there are any more letters left in this hand.
returns: True if there are no letters remaining, False otherwise.
"""
return not len(self.handDict)
def __eq__(self, other):
"""
Equality test, for testing purposes
returns: True if this Hand contains the same number of each letter as
the other Hand, False otherwise
"""
return self.handDict == other.handDict
def __str__(self):
"""
Represent this hand as a string
returns: a string representation of this hand
"""
string = ''
for letter in self.handDict.keys():
for j in range(self.handDict[letter]):
string = string + letter + ' '
return string
#
# Problem 3: Representing a Player
#
class Player(object):
"""
General class describing a player.
Stores the player's ID number, hand, and score.
"""
def __init__(self, idNum, hand):
"""
Initialize a player instance.
idNum: integer: 1 for player 1, 2 for player 2. Used in informational
displays in the GUI.
hand: An object of type Hand.
postcondition: This player object is initialized
"""
self.points = 0.
self.idNum = idNum
self.hand = hand
def getHand(self):
"""
Return this player's hand.
returns: the Hand object associated with this player.
"""
return self.hand
def addPoints(self, points):
"""
Add points to this player's total score.
points: the number of points to add to this player's score
postcondition: this player's total score is increased by points
"""
self.points += points
def getPoints(self):
"""
Return this player's total score.
returns: A float specifying this player's score
"""
return self.points
def getIdNum(self):
"""
Return this player's ID number (either 1 for player 1 or
2 for player 2).
returns: An integer specifying this player's ID number.
"""
return self.idNum
def __cmp__(self, other):
"""
Compare players by their scores.
returns: 1 if this player's score is greater than other player's score,
-1 if this player's score is less than other player's score, and 0 if
they're equal.
"""
return cmp(self.getPoints(), other.getPoints())
def __str__(self):
"""
Represent this player as a string
returns: a string representation of this player
"""
return 'Player %d\n\nScore: %.2f\n' % \
(self.getIdNum(), self.getPoints())
#
# Problem 4: Representing a Computer Player
#
class ComputerPlayer(Player):
"""
A computer player class.
Does everything a Player does, but can also pick a word using the
PickBestWord method.
"""
def pickBestWord(self, wordlist):
"""
Pick the best word available to the computer player.
returns: The best word (a string), given the computer player's hand and
the wordlist
"""
bestScore = 0
bestWord = ''
for word in wordlist.getList():
if self.hand.containsLetters(word):
wordScore = getWordScore(word)
if wordScore > bestScore:
bestScore = wordScore
bestWord = word
return bestWord
def playHand(self, callback, wordlist):
"""
Play a hand completely by passing chosen words to the callback
function.
"""
while callback(self.pickBestWord(wordlist)): pass
class HumanPlayer(Player):
"""
A Human player class.
No methods are needed because everything is taken care of by the GUI.
"""
class Wordlist(object):
"""
A word list.
"""
def __init__(self):
"""
Initializes a Wordlist object.
postcondition: words are read in from a file (WORDLIST_FILENAME, a
global constant) and stored as a list.
"""
inputFile = open(WORDLIST_FILENAME)
try:
self.wordlist = []
for line in inputFile:
self.wordlist.append(line.strip().lower())
finally:
inputFile.close()
def containsWord(self, word):
"""
Test whether this wordlist includes word
word: The word to check (a string)
returns: True if word is in this Wordlist, False if word is not in
Wordlist
"""
return word in self.wordlist
def getList(self):
return self.wordlist
class EndHand(Exception): pass
class Game(object):
"""
Stores the state needed to play a round of the word game.
"""
def __init__(self, mode, wordlist):
"""
Initializes a game.
mode: Can be one of three constant values - HUMAN_SOLO, HUMAN_VS_COMP,
and HUMAN_VS_HUMAN
postcondition: Initializes the players nd their hands.
"""
hand = Hand(HAND_SIZE)
hand2 = Hand(HAND_SIZE, hand.handDict.copy())
if mode == HUMAN_SOLO:
self.players = [HumanPlayer(1, hand)]
elif mode == HUMAN_VS_COMP:
self.players = [HumanPlayer(1, hand),
ComputerPlayer(2, hand2)]
elif mode == HUMAN_VS_HUMAN:
self.players = [HumanPlayer(1, hand),
HumanPlayer(2, hand2)]
self.playerIndex = 0
self.wordlist = wordlist
def getCurrentPlayer(self):
"""
Gets the Player object corresponding to the active player.
returns: The active Player object.
"""
return self.players[self.playerIndex]
def nextPlayer(self):
"""
Changes the game state so that the next player is the active player.
postcondition: playerIndex is incremented
"""
if self.playerIndex + 1 < len(self.players):
self.playerIndex = self.playerIndex + 1
return True
else:
return False
def gameOver(self):
"""
Determines if the game is over
returns: True if the playerIndex >= the number of players, False
otherwise
"""
return self.playerIndex >= len(self.players)
def tryWord(self, word):
if word == '.':
raise EndHand()
player = self.getCurrentPlayer()
hand = player.getHand()
if self.wordlist.containsWord(word) and hand.containsLetters(word):
points = getWordScore(word)
player.addPoints(points)
hand.update(word)
if hand.isEmpty():
raise EndHand()
return points
else:
return None
def getWinner(self):
return max(self.players)
def getNumPlayers(self):
return len(self.players)
def isTie(self):
return len(self.players) > 1 and \
self.players[0].getPoints() == self.players[1].getPoints()
def __str__(self):
"""
Convert this game object to a string
returns: the concatenation of the string representation of the players
"""
string = ''
for player in self.players:
string = string + str(player)
return string
# Test code
import ps10; reload(ps10)
from ps10 import *
def isClose(float1, float2):
"""
Helper function - are two floating point values close?
"""
return abs(float1 - float2) < .01
def testResult(boolean):
"""
Helper function - print 'Test Failed' if boolean is false, 'Test
Succeeded' otherwise.
"""
if boolean:
print 'Test Succeeded'
else:
print 'Test Failed'
def testHand():
"""
Test the hand class. Add your own test cases
"""
h = Hand(8, {'a':3, 'b':2, 'd':3})
expected = {'a': 2, 'b': 1, 'd': 2};
print("\nTesting that handDict %s is changed to %s after h.update('bad')" % (h.handDict, expected))
h.update('bad')
testResult(h.handDict == expected)
print("\nTesting that h.containsLetters('aabdd') returns True and h.isEmpty() returns False with handDict %s" % h.handDict)
testResult(h.containsLetters('aabdd') and not h.isEmpty())
expected = {'a': 1, 'b': 1}
print("\nTesting that handDict %s is changed to %s after h.update('dad')" % (h.handDict, expected))
h.update('dad')
testResult(h.handDict == expected)
print("\nTesting that h.containsLetters('ab') returns True and h.isEmpty() returns False with handDict %s" % h.handDict)
testResult(h.containsLetters('ab') and not h.isEmpty())
expected = {}
print("\nTesting that handDict %s is changed to %s after h.update('ab')" % (h.handDict, expected))
h.update('ab')
testResult(h.handDict == expected)
print("\nTesting that h.isEmpty() returns True with handDict %s" % h.handDict)
testResult(h.isEmpty())
h = Hand(8, {'a':3, 'b':2, 'd':3})
print("\nTesting that h.containsLetters('z') returns False handDict %s" % h.handDict)
testResult(not h.containsLetters('z'))
h = Hand(8, {'a':3, 'b':2, 'd':3})
oh = Hand(8, {'a':3, 'b':2, 'd':3})
print("\nTesting that hand with %s is equal to hand with %s" % (h.handDict, oh.handDict))
testResult(h == oh)
h = Hand(8, {'a':3, 'b':2, 'd':3})
oh = Hand(8, {'d':3, 'b':2, 'a':3, 'c':0})
print("\nTesting that hand with %s is equal to hand with %s" % (h.handDict, oh.handDict))
testResult(h == oh)
h = Hand(8, {'b':3, 'c':2, 'e':3})
oh = Hand(8, {'a':3, 'b':2, 'd':3})
print("\nTesting that hand with %s is not equal to hand with %s" % (h.handDict, oh.handDict))
testResult(h != oh)
def testPlayer():
"""
Test the Player class. Add your own test cases.
"""
hand = Hand(6, {'c':1, 'a':1, 'b':1 ,'d':1, 'o':1, 'e':1})
p = Player(1, hand)
print("\nTesting that p.getHand() returns an instance of Hand")
testResult(type(p.getHand()) == Hand)
print("\nTesting that the Player constructor initializes p.hand to %s, p.points to %0.1f and p.idNum to %d" % (hand, 0., 1))
testResult(p.hand == hand)
testResult(p.points == 0)
testResult(p.idNum == 1)
print("\nTesting that p.getHand() returns p.hand")
testResult(p.getHand() == p.hand)
print("\nTesting that p.getPoints returns p.points")
testResult(p.getPoints() == p.points)
print("\nTesting that p.getIdNum returns p.idNum")
testResult(p.getIdNum() == p.idNum)
print("\nTesting that calling p.addPoints(5.) and p.addPoints(12.) sets the total number of points close to 17")
p.addPoints(5.)
p.addPoints(12.)
testResult(isClose(p.getPoints(), 17))
p1 = Player(1, Hand(1, {'a': 1}))
p2 = Player(2, Hand(1, {'b': 1}))
print("\nTesting that p1 with %0.1f points is equal to p2 with %0.1f points" % (p1.getPoints(), p2.getPoints()))
testResult(p1 == p2)
p1.addPoints(1)
print("\nTesting that p1 with %0.1f points is greater than p2 with %0.1f points" % (p1.getPoints(), p2.getPoints()))
testResult(p1 > p2)
print("\nTesting that p2 with %0.1f points is less than p1 with %0.1f points" % (p2.getPoints(), p1.getPoints()))
testResult(p2 < p1)
def testComputerPlayer():
"""
Test the ComputerPlayer class. Add your own test cases.
"""
wordlist = Wordlist()
p = ComputerPlayer(1, Hand(6, {'c':1, 'a':1, 'b':1 ,'d':1, 'o':1, 'e':1}))
expected = 'abode'
print("Testing that the best word formed with the hand %s is %s and the best score possible is %0.1f" % (p.getHand(), expected, getWordScore(expected)))
bestWord = p.pickBestWord(wordlist)
testResult(bestWord == expected)
testResult(getWordScore(bestWord) == getWordScore(expected))
p = ComputerPlayer(1, Hand(7, {'h': 1, 'a': 2, 'z': 1, 'm': 3, 'o': 1, 'c': 2, 'k': 1}))
expected = 'hammock'
print("\nTesting that the best word formed with the hand %s is %s and the best score possible is %0.1f" % (p.getHand(), expected, getWordScore(expected)))
bestWord = p.pickBestWord(wordlist)
testResult(bestWord == expected)
testResult(getWordScore(bestWord) == getWordScore(expected))
p = ComputerPlayer(1, Hand(1, {'x': 1}))
expected = ''
print("\nTesting that the best word formed with the hand %s is %s and the best score possible is %0.1f" % (p.getHand(), expected, getWordScore(expected)))
bestWord = p.pickBestWord(wordlist)
testResult(bestWord == expected)
testResult(getWordScore(bestWord) == getWordScore(expected))
def testAll():
"""
Run all Tests
"""
print "Uncomment the tests in this file as you complete each problem."
print "PROBLEM 2 -----------------------------------------"
testHand()
print
print 'PROBLEM 3 -----------------------------------------'
testPlayer()
print
print 'PROBLEM 4 -----------------------------------------'
testComputerPlayer()
print
testAll()
rfh
1 year ago
|
 |
MIT OpenCourseWare 6.00 Introduction to Computer Science and Programming: Lesson 17, HW 1
A little confused as to why 1.1 is False...I thought a greedy algorithm could come up with a solution, but not necessarily an optimal one
1.1) True, though the solution might not be optimal
1.2) True, so long as they contain optimal substructure and overlapping sub problems
1.3) False, dynamic programming *can* find an optimal solution
1.4) False, Classes themselves are objects in addition to class instances
1.5) True
1.6) False, can have more than one branch
2)
def findMedian(L):
"""Finds median of L.
L: a non-empty list of floats
Returns:
If L has an odd number of elements, returns the median element of
L. For example, if L is the list [15.0, 5.3, 18.2], returns 15.0.
If L has an even number of elements, returns the average of the
two median elements. For example, if L is the list
[1.0, 2.0, 3.0, 4.0], returns 2.5.
If the list is empty, raises a ValueError exception.
Side effects: none
"""
if len(L) == 0:
raise ValueError('List cannot be empty')
sortedList = sorted(L)
if len(sortedList) % 2 != 0:
return sortedList[len(sortedList) // 2]
return (sortedList[len(sortedList) // 2 - 1] + sortedList[len(sortedList) // 2]) / 2.0
3)
16
L = [
Circle(0),
Square(1),
Circle(2),
Square(3),
Circle(4),
Square(5),
Circle(6),
Square(7),
Circle(8),
Square(9),
]
Circle with radius 4
Circle with radius 8
4) True
4.1)
n is number of items in the knapsack
p sub i is the price of the element i
x sub i is whether item i is selected for inclusion
w sub i is the weight of item i
C is a constant representing the maximum weight allowed
4.2)
formula 1 calculates all possible possible values
formula 2 calculates all possible combinations with the weight constraint
5)
merge_sort(sequence)
if length of sequence is 1,
return sequence
if length of sequence is 2,
if sequence[0] is less than sequence[1],
return sequence
else
return [sequence[1], sequence[0]]
sorted_first_half = merge_sort(first half of sequence)
sorted_second_half = merge_sort(second half of sequence)
return merge(sorted_first_half, sorted_second_half)
merge(sequence_1, sequence_2)
while sequence_1 and sequence_2 have items left
if sequence_1[0] is greater than sequence_2[0],
remove element 0 from sequence_1 and add it to sorted_sequence
else
remove element 0 form sequence_2 and add it to sorted_sequence
if sequence_1 has elements left,
add the rest of sequence_1 to sorted_sequence
if sequence_2 has elements left,
add the rest of sequence_2 to sorted_sequence
return sorted_sequence
6)
def cmpGuess(guess):
"""Assumes that guess is an integer in range(maxVal). returns -1 if
guess is < than the magic number, 0 if it is equal to the magic
number and 1 if it is greater than the magic number."""
def findNumber(maxVal):
"""Assumes that maxVal is a positive integer. Returns a number, num,
such that cmpGuess(num) == 0."""
low = 0
high = maxVal
while True:
guess = low + (high - low) / 2
result = cmpGuess(guess)
if (result == 0): return guess
if (result == -1):
low = guess
else:
high = guess
rfh
1 year ago
|
 |
MIT OpenCourseWare 6.00 Introduction to Computer Science and Programming: Lesson 16, HW 1
from string import *
class Shape(object):
def area(self):
raise AttributeException("Subclasses should override this method.")
class Square(Shape):
def __init__(self, h):
"""
h: length of side of the square
"""
self.side = float(h)
def area(self):
"""
Returns area of the square
"""
return self.side**2
def __str__(self):
return 'Square with side ' + str(self.side)
def __eq__(self, other):
"""
Two squares are equal if they have the same dimension.
other: object to check for equality
"""
return type(other) == Square and self.side == other.side
class Circle(Shape):
def __init__(self, radius):
"""
radius: radius of the circle
"""
self.radius = float(radius)
def area(self):
"""
Returns approximate area of the circle
"""
return 3.14159*(self.radius**2)
def __str__(self):
return 'Circle with radius ' + str(self.radius)
def __eq__(self, other):
"""
Two circles are equal if they have the same radius.
other: object to check for equality
"""
return type(other) == Circle and self.radius == other.radius
#
# Problem 1: Create the Triangle class
#
class Triangle(Shape):
def __init__(self, base, height):
"""
Sets the base and height
"""
self.base = float(base)
self.height = float(height)
def area(self):
"""
Calculates and returns the area
"""
return self.base * self.height / 2
def getBase(self):
return self.base
def getHeight(self):
return self.height
def __str__(self):
"""
Returns a string representation of the triangle
"""
return 'Triangle with base %0.1f and height %0.1f' % (self.base, self.height)
def __eq__(self, other):
"""
Whether the two objects are equal
"""
return type(other) == Triangle and (self.base, self.height) == (other.getBase(), other.getHeight())
#
# Problem 2: Create the ShapeSet class
#
class ShapeSet:
def __init__(self):
"""
Initialize any needed variables
"""
self.shapes = []
self.shapesCategorized = {
Circle: [],
Square: [],
Triangle: []
}
def addShape(self, sh):
"""
Add shape sh to the set; no two shapes in the set may be
identical
sh: shape to be added
"""
if type(sh) not in self.shapesCategorized:
raise ValueError('Object needs to be a Circle, Square or Triangle')
for shape in self.shapes:
if shape == sh:
raise ValueError('Duplicate Shape')
self.shapes.append(sh)
self.shapesCategorized[type(sh)].append(sh)
def __iter__(self):
"""
Return an iterator that allows you to iterate over the set of
shapes, one shape at a time
"""
self.iterPointer = 0
return self
def next(self):
if self.iterPointer >= len(self.shapes):
raise StopIteration
self.iterPointer += 1
return self.shapes[self.iterPointer - 1]
def __str__(self):
"""
Return the string representation for a set, which consists of
the string representation of each shape, categorized by type
(circles, then squares, then triangles)
"""
string = ''
for shapeType in self.shapesCategorized:
for shape in self.shapesCategorized[shapeType]:
string += shape.__str__() + "\n"
return string[:-3]
#
# Problem 3: Find the largest shapes in a ShapeSet
#
def findLargest(shapes):
"""
Returns a tuple containing the elements of ShapeSet with the
largest area.
shapes: ShapeSet
"""
largestSet = ()
for shape in shapes:
if not len(largestSet) or shape.area() > largestSet[0].area():
largestSet = (shape,)
elif shape.area() == largestSet[0].area():
largestSet += (shape,)
return largestSet
#
# Problem 4: Read shapes from a file into a ShapeSet
#
def readShapesFromFile(filename):
"""
Retrieves shape information from the given file.
Creates and returns a ShapeSet with the shapes found.
filename: string
"""
shset = ShapeSet()
for line in open(filename, 'r', 0):
shapeData = line.strip().split(',')
if shapeData[0] == 'circle':
shset.addShape(Circle(shapeData[1]))
elif shapeData[0] == 'square':
shset.addShape(Square(shapeData[1]))
elif shapeData[0] == 'triangle':
shset.addShape(Triangle(shapeData[1], shapeData[2]))
else:
raise ValueError('File contained unsupported shape: %s' % shapeData[0])
return shset
rfh
1 year ago
|
 |
MIT OpenCourseWare 6.00 Introduction to Computer Science and Programming: Lesson 14, HW 1
import time
from pprint import pprint
SUBJECT_FILENAME = "subjects.txt"
VALUE, WORK = 0, 1
#
# Problem 1: Building A Subject Dictionary
#
def loadSubjects(filename):
"""
Returns a dictionary mapping subject name to (value, work), where the name
is a string and the value and work are integers. The subject information is
read from the file named by the string filename. Each line of the file
contains a string of the form "name,value,work".
returns: dictionary mapping subject name to (value, work)
"""
subjectMapping = {}
inputFile = open(filename)
for line in inputFile:
words = line.strip().split(',')
subjectMapping[words[0]] = (int(words[1]), int(words[2]))
return subjectMapping
def printSubjects(subjects):
"""
Prints a string containing name, value, and work of each subject in
the dictionary of subjects and total value and work of all subjects
"""
totalVal, totalWork = 0,0
if len(subjects) == 0:
return 'Empty SubjectList'
res = 'Course\tValue\tWork\n======\t====\t=====\n'
subNames = subjects.keys()
subNames.sort()
for s in subNames:
val = subjects[s][VALUE]
work = subjects[s][WORK]
res = res + s + '\t' + str(val) + '\t' + str(work) + '\n'
totalVal += val
totalWork += work
res = res + '\nTotal Value:\t' + str(totalVal) +'\n'
res = res + 'Total Work:\t' + str(totalWork) + '\n'
print res
def cmpValue(subInfo1, subInfo2):
"""
Returns True if value in (value, work) tuple subInfo1 is GREATER than
value in (value, work) tuple in subInfo2
"""
val1 = subInfo1[VALUE]
val2 = subInfo2[VALUE]
return val1 > val2
def cmpWork(subInfo1, subInfo2):
"""
Returns True if work in (value, work) tuple subInfo1 is LESS than than work
in (value, work) tuple in subInfo2
"""
work1 = subInfo1[WORK]
work2 = subInfo2[WORK]
return work1 < work2
def cmpRatio(subInfo1, subInfo2):
"""
Returns True if value/work in (value, work) tuple subInfo1 is
GREATER than value/work in (value, work) tuple in subInfo2
"""
val1 = subInfo1[VALUE]
val2 = subInfo2[VALUE]
work1 = subInfo1[WORK]
work2 = subInfo2[WORK]
return float(val1) / work1 > float(val2) / work2
#
# Problem 2: Subject Selection By Greedy Optimization
#
def greedyAdvisor(subjects, maxWork, comparator):
"""
Returns a dictionary mapping subject name to (value, work) which includes
subjects selected by the algorithm, such that the total work of subjects in
the dictionary is not greater than maxWork. The subjects are chosen using
a greedy algorithm. The subjects dictionary should not be mutated.
subjects: dictionary mapping subject name to (value, work)
maxWork: int >= 0
comparator: function taking two tuples and returning a bool
returns: dictionary mapping subject name to (value, work)
"""
subjectsToTake = {}
currentBest = None
done = False
while not done:
currentBest = None
for subject in subjects:
# If we have not selected the subject already and we either
# do not have a "best" subject yet or the current subject is
# better than our current best and we can fit it in with regards
# to our maximum workload
if not(subject in subjectsToTake) and (not currentBest or comparator(subjects[subject], subjects[currentBest])) and not(maxWork - subjects[subject][1] < 0):
currentBest = subject
# Cannot fit another subject in
if not currentBest:
done = True
else:
subjectsToTake[currentBest] = subjects[currentBest]
maxWork -= subjects[currentBest][1]
return subjectsToTake
def bruteForceAdvisor(subjects, maxWork):
"""
Returns a dictionary mapping subject name to (value, work), which
represents the globally optimal selection of subjects using a brute force
algorithm.
subjects: dictionary mapping subject name to (value, work)
maxWork: int >= 0
returns: dictionary mapping subject name to (value, work)
"""
nameList = subjects.keys()
tupleList = subjects.values()
bestSubset, bestSubsetValue = \
bruteForceAdvisorHelper(tupleList, maxWork, 0, None, None, [], 0, 0)
outputSubjects = {}
for i in bestSubset:
outputSubjects[nameList[i]] = tupleList[i]
return outputSubjects
def bruteForceAdvisorHelper(subjects, maxWork, i, bestSubset, bestSubsetValue,
subset, subsetValue, subsetWork):
# Hit the end of the list.
if i >= len(subjects):
if bestSubset == None or subsetValue > bestSubsetValue:
# Found a new best.
return subset[:], subsetValue
else:
# Keep the current best.
return bestSubset, bestSubsetValue
else:
s = subjects[i]
# Try including subjects[i] in the current working subset.
if subsetWork + s[WORK] <= maxWork:
subset.append(i)
bestSubset, bestSubsetValue = bruteForceAdvisorHelper(subjects,
maxWork, i+1, bestSubset, bestSubsetValue, subset,
subsetValue + s[VALUE], subsetWork + s[WORK])
subset.pop()
bestSubset, bestSubsetValue = bruteForceAdvisorHelper(subjects,
maxWork, i+1, bestSubset, bestSubsetValue, subset,
subsetValue, subsetWork)
return bestSubset, bestSubsetValue
#
# Problem 3: Subject Selection By Brute Force
#
def bruteForceTime():
"""
Runs tests on bruteForceAdvisor and measures the time required to compute
an answer.
"""
start = time.time()
print "Starting brute force"
print bruteForceAdvisor(loadSubjects('subjects.txt'), 9)
print "Ending brute force, took %0.2f seconds" % (time.time() - start)
# Problem 3 Observations
# ======================
#
# Anything over 8 for maxWork is unreasonable (10+ seconds is too much)
#
# Problem 4: Subject Selection By Dynamic Programming
#
def dpAdvisor(subjectsInfoDict, maxWork):
"""
Returns a dictionary mapping subject name to (value, work) that contains a
set of subjectsInfoDict that provides the maximum value without exceeding maxWork.
subjectsInfoDict: dictionary mapping subject name to (value, work)
maxWork: int >= 0
returns: dictionary mapping subject name to (value, work)
"""
selectedSubjectsDict = {}
# Just the subject names
subjects = subjectsInfoDict.keys()
# Just the subject workload/value pairs
workloadValueTuples = subjectsInfoDict.values()
# Start searching for the optimal selection, starting at the top of
# the subjects stack
maxValue, selectedSubjects = dpAdvisorHelper(subjects, workloadValueTuples, len(subjects) - 1, maxWork, (), {})
for subject in selectedSubjects:
selectedSubjectsDict[subject] = subjectsInfoDict[subject]
return selectedSubjectsDict
def dpAdvisorHelper(subjects, workloadValueTuples, index, maxWork, selectedSubjects, memo):
memoIndex = (index, maxWork)
# Check if the current index/maxWork combination is memoized
try: return memo[memoIndex]
except KeyError: pass
# Index 0 means we are at the last subject
if index == 0:
# If we have room, include it, if not, do not
if workloadValueTuples[index][1] <= maxWork:
memo[memoIndex] = (workloadValueTuples[index][0], (subjects[index],))
else:
memo[memoIndex] = (0, ())
return memo[memoIndex]
# Selections if we do not choose the current subject
withoutCurrentSubject = dpAdvisorHelper(subjects, workloadValueTuples, index - 1, maxWork, selectedSubjects, memo)
# If we cannot include the current subject, then skip it
if workloadValueTuples[index][1] > maxWork:
memo[memoIndex] = withoutCurrentSubject
return memo[memoIndex]
# Get the selected subjects and maximum value with the current
# subject selected
withValue, withSelected = dpAdvisorHelper(subjects, workloadValueTuples, index - 1, maxWork - workloadValueTuples[index][1], selectedSubjects, memo)
withValue += workloadValueTuples[index][0]
without_value, without_selected = withoutCurrentSubject
# Compare the two and determine which one is better
if withValue > without_value:
memo[memoIndex] = (withValue, (subjects[index],) + withSelected)
else:
memo[memoIndex] = withoutCurrentSubject
return memo[memoIndex]
#
# Problem 5: Performance Comparison
#
def dpTime():
"""
Runs tests on dpAdvisor and measure the time required to compute
an answer.
"""
start = time.time()
print "Starting dp"
print dpAdvisor(loadSubjects('subjects.txt'), 30)
print "Ending dp, took %0.2f seconds" % (time.time() - start)
dpTime()
printSubjects(dpAdvisor(loadSubjects('subjects.txt'), 30))
# Problem 5 Observations
# ======================
#
# As the input and maximum workload grows, the dpAdvisor function gets much
# faster than the bruteForceAdvisor function. With the subjects loaded from
# the subjects.txt file and a maximum workload of 9, dpAdvisor is 2226 times
# faster.
rfh
1 year ago
|
 |
MIT OpenCourseWare 6.00 Introduction to Computer Science and Programming: Lesson 12, HW 1
# Problem 1
#
# What is the computational complexity of fact0?
#
# Linear, a constant amount of operations are called
# n times, where n is the size of the input (in this
# case an integer)
#
def fact0(i):
assert type(i) == int and i >= 0
if i == 0 or i == 1:
return 1
return i * fact0(i-1)
# Problem 2
#
# What is the computational complexity of fact1? Explain your answer.
#
# Linear, like the recursive version, a constant amount of operations
# are executed once per iteration in the while loop. The number of
# iterations is equal to the size of the input
#
def fact1(i):
assert type(i) == int and i >= 0
res = 1
while i > 1:
res = res * i
i -= 1
return res
# Problem 3
#
# What is the computational complexity of makeSet? Explain your answer.
#
# Linear, a constant amount of operations are executed once per
# iteration. The number of iterations is equal to the number of elements
# in s.
#
def makeSet(s):
assert type(s) == str
res = ''
for c in s:
if not c in res:
res = res + c
return res
# Problem 4
#
# What is the computational complexity of intersect? Explain your answer.
#
# Linear, the number of operations is O(makeSet) + O(makeSet) + the number
# of elements in s1
#
def intersect(s1, s2):
assert type(s1) == str and type(s2) == str
s1 = makeSet(s1)
s2 = makeSet(s2)
res = ''
for e in s1:
if e in s2:
res = res + e
return res
# Problem 5
#
# Present a hand simulation of the code below. Describe the value to
# which each identifier is bound after each step of the computation.
# Note that “s1” and “s2” exist in more than one scope.
#
# s1 -> [1]
# s2 -> [2]
#
# (in function)
# tmp -> [1]
# s1 -> [2]
# s2 -> [1]
#
# print s1, s2 will print [2] and [1]
#
def swap0(s1, s2):
assert type(s1) == list and type(s2) == list
tmp = s1[:]
s1 = s2[:]
s2 = tmp
return
s1 = [1]
s2 = [2]
swap0(s1, s2)
print s1, s2
# Problem 6
#
# Present a hand simulation of the following code:
#
# s1 -> [1]
# s2 -> [2]
#
# s1 -> s2
# s2 -> s1
#
# print s1, s2 will print [2] and [1]
#
def swap1(s1, s2):
assert type(s1) == list and type(s2) == list
return s2, s1
s1 = [1]
s2 = [2]
s1, s2 = swap1(s1, s2)
print s1, s2
# Problem 7
#
# Present a hand simulation of the following code:
#
# s -> [1,2,3]
#
# (in function)
# i -> 0
# tmp -> 1
# s[0] -> 3
# s[-1] -> 1
#
# print s will print [3,2,1]
#
def rev(s):
assert type(s) == list
for i in range(len(s)/2):
tmp = s[i]
s[i] = s[-(i+1)]
s[-(i+1)] = tmp
s = [1,2,3]
rev(s)
print s
rfh
1 year ago
|
 |
MIT OpenCourseWare 6.00 Introduction to Computer Science and Programming: Lesson 11, HW 1
Took me some time and going through some ugly code to come up with an algorithm to create every possible string combination for pick_best_word_faster, but the solution ended up being really simple in the end, which felt great. Not sure if problem 5 is a trick question or if my algorithm could be done more efficiently, but complexity is actually greater for pickBestWordFaster, but it only shows for a large hand size.
import random
import string
import time
VOWELS = 'aeiou'
CONSONANTS = 'bcdfghjklmnpqrstvwxyz'
HAND_SIZE = 20
POINTS_DICT = {}
SCRABBLE_LETTER_VALUES = {
'a': 1, 'b': 3, 'c': 3, 'd': 2, 'e': 1, 'f': 4, 'g': 2, 'h': 4, 'i': 1, 'j': 8, 'k': 5, 'l': 1, 'm': 3, 'n': 1, 'o': 1, 'p': 3, 'q': 10, 'r': 1, 's': 1, 't': 1, 'u': 1, 'v': 4, 'w': 4, 'x': 8, 'y': 4, 'z': 10
}
# -----------------------------------
# Helper code
# (you don't need to understand this helper code)
WORDLIST_FILENAME = "words.txt"
def load_words():
"""
Returns a list of valid words. Words are strings of lowercase letters.
Depending on the size of the word list, this function may
take a while to finish.
"""
print "Loading word list from file..."
# inFile: file
inFile = open(WORDLIST_FILENAME, 'r', 0)
# wordlist: list of strings
wordlist = []
for line in inFile:
wordlist.append(line.strip().lower())
print " ", len(wordlist), "words loaded."
return wordlist
def get_frequency_dict(sequence):
"""
Returns a dictionary where the keys are elements of the sequence
and the values are integer counts, for the number of times that
an element is repeated in the sequence.
sequence: string or list
return: dictionary
"""
# freqs: dictionary (element_type -> int)
freq = {}
for x in sequence:
freq[x] = freq.get(x,0) + 1
return freq
# (end of helper code)
# -----------------------------------
def getWordScore(word, n):
"""
Returns the score for a word. Assumes the word is a
valid word.
The score for a word is the sum of the points for letters
in the word, plus 50 points if all n letters are used on
the first go.
Letters are scored as in Scrabble; A is worth 1, B is
worth 3, C is worth 3, D is worth 2, E is worth 1, and so on.
word: string (lowercase letters)
returns: int >= 0
"""
score = 0
for letter in word:
score += SCRABBLE_LETTER_VALUES[letter]
if len(word) == n:
score += 50
return score
#
# Make sure you understand how this function works and what it does!
#
def displayHand(hand):
"""
Displays the letters currently in the hand.
For example:
displayHand({'a':1, 'x':2, 'l':3, 'e':1})
Should print out something like:
a x x l l l e
The order of the letters is unimportant.
hand: dictionary (string -> int)
"""
for letter in hand.keys():
for j in range(hand[letter]):
print letter, # print all on the same line
print # print an empty line
#
# Make sure you understand how this function works and what it does!
#
def deal_hand(n):
"""
Returns a random hand containing n lowercase letters.
At least n/3 the letters in the hand should be VOWELS.
Hands are represented as dictionaries. The keys are
letters and the values are the number of times the
particular letter is repeated in that hand.
n: int >= 0
returns: dictionary (string -> int)
"""
hand={}
num_vowels = n / 3
for i in range(num_vowels):
x = VOWELS[random.randrange(0,len(VOWELS))]
hand[x] = hand.get(x, 0) + 1
for i in range(num_vowels, n):
x = CONSONANTS[random.randrange(0,len(CONSONANTS))]
hand[x] = hand.get(x, 0) + 1
return hand
def updateHand(hand, word):
"""
Assumes that 'hand' has all the letters in word.
In other words, this assumes that however many times
a letter appears in 'word', 'hand' has at least as
many of that letter in it.
Updates the hand: uses up the letters in the given word
and returns the new hand, without those letters in it.
Has no side effects: does not mutate hand.
word: string
hand: dictionary (string -> int)
returns: dictionary (string -> int)
"""
wordFreqDict = get_frequency_dict(word)
updatedHand = {}
for letter in hand:
updatedHand[letter] = hand[letter] - wordFreqDict.get(letter, 0)
if not updatedHand[letter]:
del updatedHand[letter]
return updatedHand
def canMakeWord(word, hand):
"""
Returns True if word can be made with the provided hand,
False if it cannot
"""
wordFreqDict = get_frequency_dict(word)
for letter in wordFreqDict:
if hand.get(letter, 0) < wordFreqDict[letter]:
return False
return True
def isValidWord(word, hand, pointsDict):
"""
Returns True if word is in the word_list and is entirely
composed of letters in the hand. Otherwise, returns False.
Does not mutate hand or word_list.
word: string
hand: dictionary (string -> int)
word_list: list of lowercase strings
"""
return pointsDict.get(word, False) and canMakeWord(word, hand)
def displayHand(hand):
"""
Displays the current hand
"""
for letter in hand:
print letter,hand[letter]
def getWordInput(hand):
word = raw_input('Enter a word or . to indicate that you are finished: ')
inputIsValid = isValidWord(word, hand, POINTS_DICT) or word == '.'
while not inputIsValid:
word = raw_input('Word not valid. Please choose another word: ')
inputIsValid = isValidWord(word, hand, POINTS_DICT) or word == '.'
return word
def getWordsToPoints(wordList):
"""
Return a dict that maps every word in wordList to its point value.
"""
pointsDict = {}
for word in wordList:
pointsDict[word] = getWordScore(word, HAND_SIZE)
return pointsDict
def pickBestWord(hand, pointsDict):
"""
Return the highest scoring word from pointsDict that can be made with the given hand.
Return '.' if no words can be made with the given hand.
"""
bestScore = 0
bestWord = '.'
for word in pointsDict.keys():
if canMakeWord(word, hand) and pointsDict[word] > bestScore:
bestScore = pointsDict[word]
bestWord = word
return bestWord
def createCombinations(string):
if len(string) == 1:
return [string]
solutions = []
# Let T = the current string of letters
# Let S = the current starting letter in our string
# Let R = the rest of the string starting with the letter
# immediately following S
# Let K = the solutions for R
#
# The solution for T is is the set of
# [S] + [S + K[0], S + K[1], S + K[2], ..., S + K[n]] + K
solutions.append(string[0])
subsolutions = createCombinations(string[1:])
for subso in subsolutions:
solutions.append(string[0] + subso)
solutions.append(subso)
return solutions
def pickBestWordFaster(hand, pointsDict, wordRearrangements):
bestScore = 0
bestWord = '.'
currentHandAsString = ''
for letter in hand:
for i in range(hand[letter]):
currentHandAsString += letter
sortedCurrentHandAsString = ''.join(sorted(currentHandAsString))
allPossibleSolutions = createCombinations(sortedCurrentHandAsString)
for solution in allPossibleSolutions:
if solution in wordRearrangements and pointsDict[wordRearrangements[solution]] > bestScore:
bestScore = pointsDict[wordRearrangements[solution]]
bestWord = wordRearrangements[solution]
return bestWord
def getWordRearrangements(wordList):
"""
Builds and returns a dictionary of words where the key is composed
of all letters in a word, sorted alphabetically and the value is
the word itself.
"""
rearranged = {}
for word in wordList:
rearranged[''.join(sorted(word))] = word
return rearranged
def getTimeLimit(pointsDict, k):
"""
Return the time limit for the computer player as a function of the
multiplier k
"""
startTime = time.time()
for word in pointsDict:
get_frequency_dict(word)
getWordScore(word, HAND_SIZE)
endTime = time.time()
return (endTime - startTime) * k
def play_hand(hand, word_list):
"""
Allows the user to play the given hand, as follows:
* The hand is displayed.
* The user may input a word.
* An invalid word is rejected, and a message is displayed asking
the user to choose another word.
* When a valid word is entered, it uses up letters from the hand.
* After every valid word: the score for that word and the total
score so far are displayed, the remaining letters in the hand
are displayed, and the user is asked to input another word.
* The sum of the word scores is displayed when the hand finishes.
* The hand finishes when there are no more unused letters.
The user can also finish playing the hand by inputing a single
period (the string '.') instead of a word.
* The final score is displayed.
hand: dictionary (string -> int)
word_list: list of lowercase strings
"""
print 'Enter time limit, in seconds, for players: '
timeLimit = getTimeLimit(POINTS_DICT, 20)
print "Time Limit: %0.8f seconds " % timeLimit
timeLeft = timeLimit
print "Current Hand: "
displayHand(hand)
score = 0
gameIsDone = False
while len(hand) and not gameIsDone:
startTime = time.time()
# word = pickBestWord(hand, POINTS_DICT)
word = pickBestWordFaster(hand, POINTS_DICT, REARRANGE_DICT)
print '"%s"' % word
totalTime = time.time() - startTime
if word == '.':
gameIsDone = True
continue
print 'It took %0.10f seconds to provide an answer' % totalTime
timeLeft -= totalTime
if (timeLeft > 0):
# Only give a maximum of the total letter score
if totalTime < 1:
totalTime = 1
wordScore = getWordScore(word, HAND_SIZE) / totalTime
score += wordScore
hand = updateHand(hand, word)
print 'Score for "%s": %0.2f. Total score so far: %0.2f' % (word, wordScore, score)
print "Remaining letters: "
displayHand(hand)
else:
print "Total time exceeds %0.8f seconds" % timeLimit
gameIsDone = True
print
print "Final Score: %0.2f" % score
def play_game(word_list):
"""
Allow the user to play an arbitrary number of hands.
* Asks the user to input 'n' or 'r' or 'e'.
* If the user inputs 'n', let the user play a new (random) hand.
When done playing the hand, ask the 'n' or 'e' question again.
* If the user inputs 'r', let the user play the last hand again.
* If the user inputs 'e', exit the game.
* If the user inputs anything else, ask them again.
"""
hand = deal_hand(HAND_SIZE)
while True:
cmd = raw_input('Enter n to deal a new hand, r to replay the last hand, or e to end game: ')
if cmd == 'n':
hand = deal_hand(HAND_SIZE)
play_hand(hand.copy(), word_list)
print
elif cmd == 'r':
play_hand(hand.copy(), word_list)
print
elif cmd == 'e':
break
else:
print "Invalid command."
#
# Build data structures used for entire session and play game
#
if __name__ == '__main__':
word_list = load_words()
POINTS_DICT = getWordsToPoints(word_list)
REARRANGE_DICT = getWordRearrangements(word_list)
# for rearranged in REARRANGE_DICT:
# print "Rearranged: %s, Word: %s" % (rearranged, REARRANGE_DICT[rearranged])
play_game(word_list)
## Problem 5 ##
#
# pickBestWord:
# Need to iterate all possible words (length(words))
# size of current word * size of word list
# Seems to be quadratic
#
# pickBestWordFaster
# Need to iterate all possible subsets of sorted(hand), which is dependent
# f(x) = 1 + 2(f(x - 1))
# Problem size is doubling each step, exponential where n is the size of hand
# This seems to be faster when the hand size is less than 20
# Testing code below
#
# x = 19
# hand = deal_hand(x)
# print "Comparing pickBestWord and PickBestWordFaster with %d" % x
# start = time.time()
# word = pickBestWord(hand, POINTS_DICT)
# end = time.time()
#
# print "pickBestWord took %0.8f seconds" % (end - start)
#
# start = time.time()
# word = pickBestWordFaster(hand, POINTS_DICT, REARRANGE_DICT)
# end = time.time()
# print "pickBestWordFaster took %0.8f seconds" % (end - start)
rfh
1 year ago
|
 |
MIT OpenCourseWare 6.00 Introduction to Computer Science and Programming: Lesson 9, HW 2
import random
# -----------------------------------
# Helper code
# (you don't need to understand this helper code)
import string
WORDLIST_FILENAME = "words.txt"
def load_words():
"""
Returns a list of valid words. Words are strings of lowercase letters.
Depending on the size of the word list, this function may
take a while to finish.
"""
print "Loading word list from file..."
# inFile: file
inFile = open(WORDLIST_FILENAME, 'r', 0)
# wordlist: list of strings
wordlist = []
for line in inFile:
wordlist.append(line.strip().lower())
print " ", len(wordlist), "words loaded."
return wordlist
def get_frequency_dict(sequence):
"""
Returns a dictionary where the keys are elements of the sequence
and the values are integer counts, for the number of times that
an element is repeated in the sequence.
sequence: string or list
return: dictionary
"""
# freqs: dictionary (element_type -> int)
freq = {}
for x in sequence:
freq[x] = freq.get(x,0) + 1
return freq
# (end of helper code)
# -----------------------------------
def get_input_letter():
letter = raw_input('Input a letter: ')
while not letter in string.ascii_letters:
letter = raw_input('Invalid letter, please enter again: ')
return letter
def is_word(word, wordList):
return word in wordList
def word_starts_with(word, fragment):
return word[:len(fragment)] == fragment
def can_make_word(wordFragment, wordList):
wordLength = len(wordFragment)
for validWord in wordList:
if word_starts_with(validWord, wordFragment):
return True
return False
def ghost(wordList):
print "Welcome to Ghost!"
currentPlayer = 'Player 1'
gameDone = False
currentWordFragment = ''
while not gameDone:
print "Current Player: %s" % currentPlayer
print "The current word fragment is: '%s'" % currentWordFragment
currentWordFragment += string.lower(get_input_letter())
print "New word fragment: '%s'" % currentWordFragment
if is_word(currentWordFragment, wordList) and len(currentWordFragment) > 3:
print "'%s' lost because he or she spelled a word" % currentPlayer
gameDone = True
elif not can_make_word(currentWordFragment, wordList):
print "'%s' lost because no word starts with '%s'" % (currentPlayer, currentWordFragment)
gameDone = True
elif currentPlayer == 'Player 1':
currentPlayer = 'Player 2'
else:
currentPlayer = 'Player 1'
print
# Actually load the dictionary of words and point to it with
# the wordList variable so that it can be accessed from anywhere
# in the program.
wordList = load_words()
ghost(wordList)
rfh
1 year ago
|
 |
MIT OpenCourseWare 6.00 Introduction to Computer Science and Programming: Lesson 9, HW 1
# Problem Set 5: 6.00 Word Game
# Name:
# Collaborators:
# Time:
#
import random
import string
VOWELS = 'aeiou'
CONSONANTS = 'bcdfghjklmnpqrstvwxyz'
HAND_SIZE = 7
SCRABBLE_LETTER_VALUES = {
'a': 1, 'b': 3, 'c': 3, 'd': 2, 'e': 1, 'f': 4, 'g': 2, 'h': 4, 'i': 1, 'j': 8, 'k': 5, 'l': 1, 'm': 3, 'n': 1, 'o': 1, 'p': 3, 'q': 10, 'r': 1, 's': 1, 't': 1, 'u': 1, 'v': 4, 'w': 4, 'x': 8, 'y': 4, 'z': 10
}
# -----------------------------------
# Helper code
# (you don't need to understand this helper code)
WORDLIST_FILENAME = "words.txt"
def load_words():
"""
Returns a list of valid words. Words are strings of lowercase letters.
Depending on the size of the word list, this function may
take a while to finish.
"""
print "Loading word list from file..."
# inFile: file
inFile = open(WORDLIST_FILENAME, 'r', 0)
# wordlist: list of strings
wordlist = []
for line in inFile:
wordlist.append(line.strip().lower())
print " ", len(wordlist), "words loaded."
return wordlist
def get_frequency_dict(sequence):
"""
Returns a dictionary where the keys are elements of the sequence
and the values are integer counts, for the number of times that
an element is repeated in the sequence.
sequence: string or list
return: dictionary
"""
# freqs: dictionary (element_type -> int)
freq = {}
for x in sequence:
freq[x] = freq.get(x,0) + 1
return freq
# (end of helper code)
# -----------------------------------
#
# Problem #1
#
# The function get_word_score should accept a string of lowercase
# letters as input (a word) and return the integer score for that word,
# using the game's scoring rules.
def get_word_score(word, n):
"""
Returns the score for a word. Assumes the word is a
valid word.
The score for a word is the sum of the points for letters
in the word, plus 50 points if all n letters are used on
the first go.
Letters are scored as in Scrabble; A is worth 1, B is
worth 3, C is worth 3, D is worth 2, E is worth 1, and so on.
word: string (lowercase letters)
returns: int >= 0
"""
score = 0
for letter in word:
score += SCRABBLE_LETTER_VALUES[letter]
if len(word) == n:
score += 50
return score
#
# Make sure you understand how this function works and what it does!
#
def display_hand(hand):
"""
Displays the letters currently in the hand.
For example:
display_hand({'a':1, 'x':2, 'l':3, 'e':1})
Should print out something like:
a x x l l l e
The order of the letters is unimportant.
hand: dictionary (string -> int)
"""
for letter in hand.keys():
for j in range(hand[letter]):
print letter, # print all on the same line
print # print an empty line
#
# Make sure you understand how this function works and what it does!
#
def deal_hand(n):
"""
Returns a random hand containing n lowercase letters.
At least n/3 the letters in the hand should be VOWELS.
Hands are represented as dictionaries. The keys are
letters and the values are the number of times the
particular letter is repeated in that hand.
n: int >= 0
returns: dictionary (string -> int)
"""
hand={}
num_vowels = n / 3
for i in range(num_vowels):
x = VOWELS[random.randrange(0,len(VOWELS))]
hand[x] = hand.get(x, 0) + 1
for i in range(num_vowels, n):
x = CONSONANTS[random.randrange(0,len(CONSONANTS))]
hand[x] = hand.get(x, 0) + 1
return hand
#
# Problem #2
#
# Implement the update_hand function. Make sure this function has no
# side effects; i.e., it cannot mutate the hand passed in.
def update_hand(hand, word):
"""
Assumes that 'hand' has all the letters in word.
In other words, this assumes that however many times
a letter appears in 'word', 'hand' has at least as
many of that letter in it.
Updates the hand: uses up the letters in the given word
and returns the new hand, without those letters in it.
Has no side effects: does not mutate hand.
word: string
hand: dictionary (string -> int)
returns: dictionary (string -> int)
"""
wordFreqDict = get_frequency_dict(word)
updatedHand = {}
for letter in hand:
updatedHand[letter] = hand[letter] - wordFreqDict.get(letter, 0)
if not updatedHand[letter]:
del updatedHand[letter]
return updatedHand
#
# Problem #3
#
# Implement the is_valid_word function
def is_valid_word(word, hand, word_list):
"""
Returns True if word is in the word_list and is entirely
composed of letters in the hand. Otherwise, returns False.
Does not mutate hand or word_list.
word: string
hand: dictionary (string -> int)
word_list: list of lowercase strings
"""
if word not in word_list:
return False
wordFreqDict = get_frequency_dict(word)
for letter in wordFreqDict:
if hand.get(letter, 0) < wordFreqDict[letter]:
return False
return True
#
# Problem #4
#
# Implement the play_hand function. This function allows the user to
# play out a single hand.
def play_hand(hand, word_list):
"""
Allows the user to play the given hand, as follows:
* The hand is displayed.
* The user may input a word.
* An invalid word is rejected, and a message is displayed asking
the user to choose another word.
* When a valid word is entered, it uses up letters from the hand.
* After every valid word: the score for that word and the total
score so far are displayed, the remaining letters in the hand
are displayed, and the user is asked to input another word.
* The sum of the word scores is displayed when the hand finishes.
* The hand finishes when there are no more unused letters.
The user can also finish playing the hand by inputing a single
period (the string '.') instead of a word.
* The final score is displayed.
hand: dictionary (string -> int)
word_list: list of lowercase strings
"""
print "Current Hand: ", hand
score = 0
user_terminated_game = False
while len(hand) and not user_terminated_game:
word = raw_input('Enter a word or . to indicate that you are finished: ')
word_is_valid = is_valid_word(word, hand, word_list) or word == '.'
while not word_is_valid:
word = raw_input('Word not valid. Please choose another word: ')
word_is_valid = is_valid_word(word, hand, word_list) or word == '.'
if word == '.':
user_terminated_game = True
continue
word_score = get_word_score(word, HAND_SIZE)
score += word_score
hand = update_hand(hand, word)
print "Score for " + word + ": ", word_score
print "Total score so far: ", score
print "Remaining letters: ", hand
print "Final Score: ", score
#
# Problem #5
#
# Make sure you understand how this code works!
#
def play_game(word_list):
"""
Allow the user to play an arbitrary number of hands.
* Asks the user to input 'n' or 'r' or 'e'.
* If the user inputs 'n', let the user play a new (random) hand.
When done playing the hand, ask the 'n' or 'e' question again.
* If the user inputs 'r', let the user play the last hand again.
* If the user inputs 'e', exit the game.
* If the user inputs anything else, ask them again.
"""
hand = deal_hand(HAND_SIZE) # random init
while True:
cmd = raw_input('Enter n to deal a new hand, r to replay the last hand, or e to end game: ')
if cmd == 'n':
hand = deal_hand(HAND_SIZE)
play_hand(hand.copy(), word_list)
print
elif cmd == 'r':
play_hand(hand.copy(), word_list)
print
elif cmd == 'e':
break
else:
print "Invalid command."
#
# Build data structures used for entire session and play game
#
if __name__ == '__main__':
word_list = load_words()
play_game(word_list)
rfh
1 year ago
|
 |
MIT OpenCourseWare 6.00 Introduction to Computer Science and Programming: Lesson 8, HW 1
1) Are each of the following True or False:
1.1. Any program that can be written using only function definitions and calls, the basic arithmetic operators, assignment, and conditionals will run in constant time.
False
1.2. Newton’s method will always converge on a correct root of a function.
True
1.3. In Python, dictionaries are immutable.
False
1.4. The value of ‘math.sqrt(2.0)*math.sqrt(2.0) == 2.0’ is True.
False
1.5. One should always avoid iteration when a recursive solution is possible.
False
1.6. Typically, the use of functions in a program reduces the total number of lines of code.
True
1.7. In Python, retrieving the value associated with a dictionary key takes roughly constant time.
True
2) Consider the implementations of compare1 and compare 2, where a and b are floats.
2.1) Do compare1 and compare2 return the same value for all possible inputs? If not, give a pair of inputs for which they return a different value.
Yes
2.2) Do compare1 and compare2 print the same thing for all possible inputs? If not, give a pair of inputs for which they print different things.
No, they will print different results when provided a negative number for either a or b. compare1 modifies the actual parameter used for both comparing and printing the result, whereas compare2 keeps the original value when printing.
compare1(-1, -2)
Results in
1 and 2 have the same absolute value.
compare2(-1, -2)
Results in
-1 and -2 have the same absolute value.
3) Consider the following implementation of a function f, where x is a positive integer:
def f(x):
xs = str(x)
if len(xs) == 1:
return int(xs)
n = int(xs[0]) + int(xs[1])
if len(xs) == 2:
return n
else:
return n + f(xs[2:])
What does f(2112) return?
xs = "2112"
n = 2 + 1
n = 3
xs = "12"
n = 1 + 2
n = 3
n = 6
3.2) Write a specification of f.
Returns the sum of all individual integers
4) Provide a Python implementation of a function first_N that takes a positive integer, n, as its only argument. The function should print the first n perfect squares that are not even numbers. E.g., if n were 2 it should print the perfect squares 1 and 9.
def first_N(n):
currentRoot = 1
while n > 0:
if (currentRoot * currentRoot) % 2 != 0:
print (currentRoot * currentRoot)
n = n - 1
currentRoot = currentRoot + 1
5) Write pseudo code for an exhaustive enumeration variant of guess and check.
function guessandcheck(guess, values)
iterate through all possible combinations
if current value is same as guess, return guess
else, next combo
6) Provide a Python implementation for the function findSide specified below
def findSide():
"""asks the user to enter the area of a rectangle and the length of one side of the rectangle.
Returns a floating point number that is the length of the adjacent side."""
print "Enter area of rectangle"
area = float(raw_input())
print "Enter length of one side"
side = float(raw_input())
return (area / side)
7) Does the following function meet its specification? If not, change the program so that it is consistent with the specification.
def f(L):
"""Returns a copy of the list L without modifying L."""
result = []
for e in L:
result = result + e
return result
Yes
8) At McDonalds one can buy chicken nuggets in packages containing 6, 9 or 20 pieces. Write a Python function that accepts an integer, num, as an argument and decides whether or not it is possible to buy num nuggets at McDonalds.
def can_buy_nuggets_for_size(size):
for a in range(0, (size / 6)):
for b in range(0, (size / 9)):
for c in range(0, (size / 20)):
current_combo = (6 * a) + (9 * b) + (20 * c)
if current_combo == size:
return True
return False
9) Write an appropriate specification for the function below. Assume that n is an integer.
def f(n):
"""
Reverses the characters in n
"""
s = str(n)
if len(s) <= 1: return s
return s[-1] + f(int(s[:-1]))
rfh
1 year ago
|
 |
MIT OpenCourseWare 6.00 Introduction to Computer Science and Programming: Lesson 7, HW 1
# Problem 1
#
# Write a function, called nestEggFixed, which takes four arguments: a
# salary, a percentage of your salary to save in an investment account,
# an annual growth percentage for the investment account, and a number
# of years to work. This function should return a list, whose values are
# the size of your retirement account at the end of each year, with the
# most recent year's value at the end of the list.
def nestEggFixed(salary, save, growthRate, years):
"""
- salary: the amount of money you make each year.
- save: the percent of your salary to save in the investment account each
year (an integer between 0 and 100).
- growthRate: the annual percent increase in your investment account (an
integer between 0 and 100).
- years: the number of years to work.
- return: a list whose values are the size of your retirement account at
the end of each year.
"""
yearlyAddAmount = salary * .01 * save
savingsEachYear = (yearlyAddAmount,)
for year in range(1, years):
lastYearsBalance = savingsEachYear[-1]
thisYearsBalance = lastYearsBalance * (1 + .01 * growthRate) + yearlyAddAmount
savingsEachYear = savingsEachYear + (thisYearsBalance,)
return savingsEachYear
def testNestEggFixed():
salary = 10000
save = 10
growthRate = 15
years = 5
print "Testing nestEggFixed with salary: %d, save: %d, growthRate: %d, years: %d" % (salary, save, growthRate, years)
savingsRecord = nestEggFixed(salary, save, growthRate, years)
print "Should be", (1000.0, 2150.0, 3472.5, 4993.375, 6742.3812499999995)
print "Is actually", savingsRecord
# TODO: Add more test cases here.
assert savingsRecord[0] < savingsRecord[1]
assert savingsRecord[1] < savingsRecord[2]
assert savingsRecord[2] < savingsRecord[3]
assert savingsRecord[3] < savingsRecord[4]
#
# Problem 2
#
# Write a function, called nestEggVariable, which takes three arguments:
# a salary (salary), a percentage of your salary to save (save), and a
# list of annual growth percentages on investments (growthRates). The
# length of the last argument defines the number of years you plan to
# work; growthRates[0] is the growth rate of the first year,
# growthRates[1] is the growth rate of the second year, etc. (Note that
# because the retirement fund's initial value is 0, growthRates[0] is,
# in fact, irrelevant.) This function should return a list, whose values
# are the size of your retirement account at the end of each year.
def nestEggVariable(salary, save, growthRates):
"""
- salary: the amount of money you make each year.
- save: the percent of your salary to save in the investment account each
year (an integer between 0 and 100).
- growthRate: a list of the annual percent increases in your investment
account (integers between 0 and 100).
- return: a list of your retirement account value at the end of each year.
"""
yearlyAddAmount = salary * .01 * save
savingsEachYear = (yearlyAddAmount,)
years = len(growthRates)
for year in range(1, years):
lastYearsBalance = savingsEachYear[-1]
thisYearsBalance = lastYearsBalance * (1 + .01 * growthRates[year]) + yearlyAddAmount
savingsEachYear = savingsEachYear + (thisYearsBalance,)
return savingsEachYear
def testNestEggVariable():
salary = 10000
save = 10
growthRates = [3, 4, 5, 0, 3]
print "Testing nestEggVariable with salary: %d, save: %d, growthRates: " % (salary, save), growthRates
savingsRecord = nestEggVariable(salary, save, growthRates)
print "Should be", (1000.0, 2040.0, 3142.0, 4142.0, 5266.2600000000002)
print "Is actually", savingsRecord
assert savingsRecord[0] < savingsRecord[1]
assert savingsRecord[1] < savingsRecord[2]
assert savingsRecord[2] < savingsRecord[3]
assert savingsRecord[3] < savingsRecord[4]
#
# Problem 3
#
# Write a function, called postRetirement, which takes three arguments:
# an initial amount of money in your retirement fund (savings), a list
# of annual growth percentages on investments while you are retired
# (growthRates), and your annual expenses (expenses). Assume that the
# increase in the investment account savings is calculated before
# subtracting the annual expenditures (as shown in the above table).
# Your function should return a list of fund sizes after each year of
# retirement, accounting for annual expenses and the growth of the
# retirement fund. Like problem 2, the length of the growthRates
# argument defines the number of years you plan to be retired.
#
# Note that if the retirement fund balance becomes negative,
# expenditures should continue to be subtracted, and the growth rate
# comes to represent the interest rate on the debt (i.e. the formulas in
# the above table still apply).
#
def postRetirement(savings, growthRates, expenses):
"""
- savings: the initial amount of money in your savings account.
- growthRate: a list of the annual percent increases in your investment
account (an integer between 0 and 100).
- expenses: the amount of money you plan to spend each year during
retirement.
- return: a list of your retirement account value at the end of each year.
"""
year1 = savings * (1 + 0.01 * growthRates[0]) - expenses
savingsEachYear = (year1,)
years = len(growthRates)
for year in range(1, years):
lastYearsBalance = savingsEachYear[-1]
thisYearsBalance = lastYearsBalance * (1 + 0.01 * growthRates[year]) - expenses
savingsEachYear = savingsEachYear + (thisYearsBalance,)
return savingsEachYear
def testPostRetirement():
savings = 100000
growthRates = [10, 5, 0, 5, 1]
expenses = 30000
print "Testing postRetirement with savings: %d, expenses: %d, growthRates: " % (savings, expenses), growthRates
savingsRecord = postRetirement(savings, growthRates, expenses)
print "Should be", (80000.000000000015, 54000.000000000015, 24000.000000000015, -4799.9999999999854, -34847.999999999985)
print "Is actually", savingsRecord
assert savingsRecord[0] > savingsRecord[1]
assert savingsRecord[1] > savingsRecord[2]
assert savingsRecord[2] > savingsRecord[3]
assert savingsRecord[3] > savingsRecord[4]
#
# Problem 4
#
# Write a function, called findMaxExpenses, which takes five arguments:
# a salary (salary), a percentage of your salary to save (save), a list
# of annual growth percentages on investments while you are still
# working (preRetireGrowthRates), a list of annual growth percentages on
# investments while you are retired (postRetireGrowthRates), and a value
# for epsilon (epsilon). As with problems 2 and 3, the lengths of
# preRetireGrowthRates and postRetireGrowthRates determine the number of
# years you plan to be working and retired, respectively.
def findMaxExpenses(salary, save, preRetireGrowthRates, postRetireGrowthRates,
epsilon):
"""
- salary: the amount of money you make each year.
- save: the percent of your salary to save in the investment account each
year (an integer between 0 and 100).
- preRetireGrowthRates: a list of annual growth percentages on investments
while you are still working.
- postRetireGrowthRates: a list of annual growth percentages on investments
while you are retired.
- epsilon: an upper bound on the absolute value of the amount remaining in
the investment fund at the end of retirement.
"""
yearsWorking = len(preRetireGrowthRates)
yearsRetired = len(postRetireGrowthRates)
savings = nestEggVariable(salary, save, preRetireGrowthRates)[-1]
count = 0
low = 0
high = savings
guess = (high - low) / 2
finalBalance = epsilon + 1
while abs(finalBalance) >= epsilon:
print "Current guess for expenses: %0.2f" % guess
finalBalance = postRetirement(savings, postRetireGrowthRates, guess)[-1]
print "Final balance for this guess is: %0.8f" % finalBalance
if (finalBalance < epsilon):
high = guess
else:
low = guess
guess = (high - low) / 2 + low
assert count < 100, 'Maximum number of iterations exceeded'
return guess
def testFindMaxExpenses():
salary = 10000
save = 10
preRetireGrowthRates = [3, 4, 5, 0, 3]
postRetireGrowthRates = [10, 5, 0, 5, 1]
epsilon = .01
print "Testing findMaxExpenses with salary: %d, save: %d, epsilon: %0.2f, pre & post retirement growth rates respectively" % (salary, save, epsilon), preRetireGrowthRates, postRetireGrowthRates
expenses = findMaxExpenses(salary, save, preRetireGrowthRates,
postRetireGrowthRates, epsilon)
print "Should be close to 1229.95548986"
print "Is actually %0.8f" % expenses
testNestEggFixed()
print
testNestEggVariable()
print
testPostRetirement()
print
testFindMaxExpenses()
rfh
1 year ago
|
 |
MIT OpenCourseWare 6.00 Introduction to Computer Science and Programming: Lesson 5, HW 1
Modified the test function for problem 3 to provide better debugging feedback
from string import *
# Problem 1
#
# Write two functions, called countSubStringMatch and
# countSubStringMatchRecursive that take two arguments, a key string and
# a target string. These functions iteratively and recursively count the
# number of instances of the key in the target string. You should
# complete definitions for
#
# def countSubStringMatch(target,key):
#
# and
#
# def countSubStringMatchRecursive (target, key):
# Iterative function counts number of instances of "key" in "target"
def countSubStringMatch(target, key):
"""
Iterative function counts number of instances of "key" in "target"
"""
found = 0
current = find(target, key)
while current != -1:
found = found + 1
current = find(target, key, current +1)
return found
key = 'abc'
target = 'abcdabce'
print "Iterative implementation of 'countSubStringMatch' found '%s' %d times in '%s'" % (key, countSubStringMatch(target, key), target)
def countSubStringMatchRecursive(target, key):
"""
Recursive function counts number of instances of "key" in "target"
"""
index = find(target, key)
if index == -1:
return 0
nextIndex = index + 1
return 1 + countSubStringMatchRecursive(target[nextIndex:], key)
key = 'abc'
target = 'abcdabce'
print "Recursive implementation of 'countSubStringMatch' found '%s' %d times in '%s'" % (key, countSubStringMatchRecursive(target, key), target)
print
# Problem 2
#
# Write the function subStringMatchExact. This function takes two
# arguments: a target string, and a key string. It should return a tuple
# of the starting points of matches of the key string in the target
# string, when indexing starts at 0. Complete the definition for
#
# def subStringMatchExact(target,key):
#
# For example,
#
# subStringMatchExact("atgacatgcacaagtatgcat","atgc")
#
# would return the tuple (5, 15).
def subStringMatchExact(target, key):
"""
Returns a tuple containing all starting indexes for found matches of
key in target
"""
foundIndexes = ()
current = find(target, key)
while current != -1:
foundIndexes = foundIndexes + (current,)
current = find(target, key, current + 1)
return foundIndexes
# target strings
target1 = 'atgacatgcacaagtatgcat'
target2 = 'atgaatgcatggatgtaaatgcag'
# key strings
key10 = 'a'
key11 = 'atg'
key12 = 'atgc'
key13 = 'atgca'
print "target: '%s', key: '%s', indexes: " % (target1, key10), subStringMatchExact(target1, key10)
print "target: '%s', key: '%s', indexes: " % (target1, key11), subStringMatchExact(target1, key11)
print "target: '%s', key: '%s', indexes: " % (target1, key12), subStringMatchExact(target1, key12)
print "target: '%s', key: '%s', indexes: " % (target1, key13), subStringMatchExact(target1, key13)
print
print "target: '%s', key: '%s', indexes: " % (target2, key10), subStringMatchExact(target2, key10)
print "target: '%s', key: '%s', indexes: " % (target2, key11), subStringMatchExact(target2, key11)
print "target: '%s', key: '%s', indexes: " % (target2, key12), subStringMatchExact(target2, key12)
print "target: '%s', key: '%s', indexes: " % (target2, key13), subStringMatchExact(target2, key13)
print
# Problem 3
#
# Write a function, called constrainedMatchPair which takes three
# arguments: a tuple representing starting points for the first
# substring, a tuple representing starting points for the second
# substring, and the length of the first substring. The function should
# return a tuple of all members (call it n) of the first tuple for which
# there is an element in the second tuple (call it k) such that
# n+m+1 = k, where m is the length of the first substring.
def constrainedMatchPair(firstMatches, secondMatches, length):
"""
Returns a tuple of all starting indexes for the provided tuple of
first matches that have a corresponding index in secondMatches such
that the index in second match starts directly when the index from
the first match ends
"""
foundMatches = ()
for firstMatch in firstMatches:
for secondMatch in secondMatches:
if (firstMatch + length + 1) == secondMatch:
foundMatches = foundMatches + (firstMatch,)
return foundMatches
# Test function
def subStringMatchOneSub(key,target):
"""
search for all locations of key in target, with one substitution
"""
allAnswers = ()
print "key: '%s', target: '%s'" % (key, target)
for miss in range(0,len(key)):
# miss picks location for missing element
# key1 and key2 are substrings to match
key1 = key[:miss]
key2 = key[miss+1:]
print "breaking '%s' into '%s' and '%s'" % (key, key1, key2)
# match1 and match2 are tuples of locations of start of matches
# for each substring in target
match1 = subStringMatchExact(target,key1)
match2 = subStringMatchExact(target,key2)
# when we get here, we have two tuples of start points
# need to filter pairs to decide which are correct
filtered = constrainedMatchPair(match1,match2,len(key1))
allAnswers = allAnswers + filtered
print "matches for '%s': " % (key1,), match1
print "matches for '%s': " % (key2,), match2
print "possible matches for '%s*%s' start at: " % (key1, key2), filtered
return allAnswers
subStringMatchOneSub(key11, target1)
print
# Problem 4
#
# Write a function, called subStringMatchExactlyOneSub which takes two
# arguments: a target string and a key string. This function should
# return a tuple of all starting points of matches of the key to the
# target, such that at exactly one element of the key is incorrectly
# matched to the target. Complete the definition
def subStringMatchExactlyOneSub(target, key):
"""
Returns a tuple of all starting points for matches of key in target
such that one character in the match is incorrect
"""
print "Looking for instances of '%s' with exactly one substitution in '%s'" % (key, target)
exactMatches = subStringMatchExact(target, key)
partialAndExactMatches = ()
for gap in range(0, len(key)):
key1 = key[:gap]
key2 = key[gap+1:]
print "Splitting '%s' into '%s' and '%s'" % (key, key1, key2)
match1 = subStringMatchExact(target, key1)
print "Exact matches for '%s':" % (key1), match1
match2 = subStringMatchExact(target, key2)
print "Exact matches for '%s':" % (key2), match2
currentPartialAndExactMatches = constrainedMatchPair(match1, match2, len(key1))
print "Partial and exact matches for '%s*%s': " % (key1, key2), currentPartialAndExactMatches
partialAndExactMatches = partialAndExactMatches + currentPartialAndExactMatches
partialMatches = ()
for candidate in partialAndExactMatches:
if not candidate in exactMatches:
partialMatches = partialMatches + (candidate,)
return partialMatches
target = 'azcdabzdabcadcd'
key = 'abcd'
matchesExactlyOneSub = subStringMatchExactlyOneSub(target, key)
print "Matches in '%s' for '%s' with exactly 1 substitution: " % (target, key), matchesExactlyOneSub
rfh
1 year ago
|
 |
MIT OpenCourseWare 6.00 Introduction to Computer Science and Programming: Lesson 3, HW 1
# Problem 1 Part 1
lookingFor = (50, 51, 52, 53, 54, 55)
for a in range(0, 55 / 6 + 1):
for b in range(0, 55 / 9 + 1):
for c in range(0, 55 / 20 + 1):
solution = (6 * a) + (9 * b) + (20 * c)
if solution in lookingFor:
print "Combination found for %d: (%d packages of 6, %d packages of 9, %d packages of 20)" % (solution, a, b, c)
# Problem 2
#
# Because we know there is a valid combination for purchasing 50, 51,
# 52, 53, 54 and 55 Chicken McNuggets, and because we are able to
# purchase packages in sizes 6 or 9, we know there must be valid combinations
# for purchasing 56-65 as we only need to add another package of "6" to our
# solution for purchasing "50" to get "56", another package of "6" to
# our solution for purchasing "51" to get "57", another package of "6"
# to our solution for purchasing "52" to get "58", another package of "6"
# to our solution for purchasing "53" or another package of "9" to our
# solution for puchasing "50" to get "59", etc.
# Problem 3
#
# Use this to write an exhaustive search to find the *largest* number of
# chicken nuggets that *cannot* be bought
foundInARow = 0
maxThatCannotBePurchased = 0
for i in range(0, 50):
canPurchaseThisAmount = False
for a in range(0, i / 6 + 1):
for b in range(0, i / 9 + 1):
for c in range(0, i / 20 + 1):
solution = (6 * a) + (9 * b) + (20 * c)
if solution == i:
canPurchaseThisAmount = True
if canPurchaseThisAmount:
foundInARow += 1
if 6 == foundInARow:
break;
else:
foundInARow = 0
maxThatCannotBePurchased = i
print "Largest number of McNuggets that cannot be bought in exact quantity: %d" % maxThatCannotBePurchased
# Problem 4
#
# Assume that the variable packages is bound to a tuple of length 3, the
# values of which specify the sizes of the packages, ordered from
# smallest to largest. Write a program that uses exhaustive search to
# find the largest number (less than 200) of McNuggets that cannot be
# bought in exact quantity.
packages = (15, 24, 32)
maxThatCannotBePurchased = 0
for i in range(0, 200):
canPurchaseThisAmount = False
for a in range(0, i / packages[0] + 1):
for b in range(0, i / packages[1] + 1):
for c in range(0, i / packages[2] + 1):
solution = (packages[0] * a) + (packages[1] * b) + (packages[2] * c)
if solution == i:
canPurchaseThisAmount = True
if canPurchaseThisAmount:
foundInARow += 1
if packages[0] == foundInARow:
break;
else:
foundInARow = 0
maxThatCannotBePurchased = i
print "Given that sizes %d, %d, and %d, the largest number of McNuggets that cannot be bought in exact quantity is: %d" % (packages[0], packages[1], packages[2], maxThatCannotBePurchased)
rfh
1 year ago
|
 |
MIT OpenCourseWare 6.00 Introduction to Computer Science and Programming: Lesson 2, HW 1
# Problem 1
#
# Write a program that computes and prints out the 1000th prime number
from math import *
def isPrime(number):
"""
Determines whether 'number' is prime or not.
"""
# Guard clauses
if 1 >= number: return False
elif 2 == number: return True
divisor = 2
# Only need to try divisors less than half of 'number'
# as
#
# number / divisor
# for all: (number / 2) < divisor < number
#
# will never divide evenly
while divisor < number // 2:
if 0 == number % divisor: return False
divisor += 1
return True
primeCounter = 1
current = 3
print "Found Prime: #1: 2"
while (primeCounter < 1000):
if isPrime(current):
primeCounter += 1
print "Found Prime: #%d: %d" % (primeCounter, current)
current += 2
# Problem 2
#
# Write a program that prints the sum of log(x) where x is every prime number less than n.
# It should also print out the number n and the ratio of these two quantities.
from math import *
n = 500
current = 3
primeLogSum = log(2)
while current <= n:
if isPrime(current):
primeLogSum += log(current)
current += 2
print "Sum of logarithms: %s" % str(primeLogSum)
print "n: %s" % str(n)
print "ratio: %s" % str(primeLogSum / n)
rfh
1 year ago
|
 |
|
|
|