Learn faster and stay on-track by joining this free class with other self-learners.
Register for MIT OpenCourseWare 6.00 Introduction to Computer Science and Programming now.
|
MIT OpenCourseWare 6.00 Introduction to Computer Science and ProgrammingClass length: 24 weeks. Start anytime. Creator: duallain Status: Established |
Join this class! |
|
Lesson 5: Assignment 1Assignment 3: Matching strings: a biological perspective Homework Submissions33 totalit took me a while to finish this assignment, i had trouble understanding what they wanted me to do in the last two problems.....gladly i think i have done it properly :) from string import *
# target strings
target1 = 'atgacatgcacaagtatgcat'
target2 = 'atgaatgcatggatgtaaatgcag'
# key strings
key10 = 'a'
key11 = 'atg'
key12 = 'atgc'
key13 = 'atgca'
#####################################
##### Problem Set 1 #####
##### Name: Wolfei #####
##### Collaborators: Internet #####
##### Time: pending #####
def countSubStringMatch(target, key):
instance = 0
w = 0
while find(target, key, w) != -1:
instance += 1
w = find(target, key, w) + 1
return instance
def countSubStringMatchRecursive(target, key):
instance = 0
for lmao in range(0,len(target)):
if target[lmao:len(key)+lmao] == key:
instance += 1
return instance
#####################################
##### Problem Set 2 #####
##### Name: Wolfei #####
##### Collaborators: Internet #####
##### Time: pending #####
def subStringMatchExact(target, key):
instance = 0
w = 0
group = ()
while find(target, key, w) != -1:
group = group + (find(target,key,w),)
instance += 1
w = find(target, key, w) + 1
return group
def subStringMatchExact2(target, key):
group = ()
instance = 0
for lmao in range(0,len(target)):
if target[lmao:len(key)+lmao] == key:
group = group + (lmao,)
instance += 1
return group
#####################################
##### Problem Set 3 #####
##### Name: Wolfei #####
##### Collaborators: Internet #####
##### Time: pending #####
### Function given to help complete problem 3
def subStringMatchOneSub(target,key):
"""search for all locations of key in target, with one substitution"""
allAnswers = ()
if len(key) != 1:
for miss in range(0,len(key)):
# miss picks location for missing element
# key1 and key2 are substrings to match
key1 = key[:miss]
key2 = key[miss+1:]
## print 'breaking key',key,'into',key1,key2
# match1 and match2 are tuples of locations of start of matches
# for each substring in target
match1 = subStringMatchExact(target,key1)
match2 = subStringMatchExact(target,key2)
## print match1, match2
# when we get here, we have two tuples of start points
# need to filter pairs to decide which are correct
filtered = constrainedMatchPair(match1,match2,len(key1))
allAnswers = allAnswers + filtered
## print 'match1',match1
## print 'match2',match2
## print 'possible matches for',key1,key2,'start at',filtered
return allAnswers
else: return " your key has only 1 character, therefore it could substitude all characters in the string"
def constrainedMatchPair(firstMatch,secondMatch,length):
group = ()
for lmao in secondMatch:
for lol in firstMatch:
if lol+length+1 == lmao:
group = group + (lol,)
return group
#####################################
##### Problem Set 4 #####
##### Name: Wolfei #####
##### Collaborators: Internet #####
##### Time: pending #####
def subStringMatchExactlyOneSub(target,key):
x = subStringMatchOneSub(target,key) #long one
y = subStringMatchExact(target,key) #short one
if len(key) != 1:
## print x,y
## print subStringMatchExactlyOneSub(x,y)
x, y = givenumbers(x,y)
if len(x) == 0:
print "there isn't an incorrect character in the string "
else:
print " This is your number"
return x
else:return " your key needs at least two characters in it"
def givenumbers(x,y):
## tuple(x)
## tuple(y)
for n in range(len(y)):
dummy03(x,y)
x, y = dummy03(x,y)
## print dummy03(x,y)
## print x, y
return x , y
def dummy03(x,y):
## a = subStringMatchOneSub(key,target) long one
## b = subStringMatchExact(target,key) short one
## group = ()
## x = 5,15,5,15,0,15,5
## y = 5,15
group = ()
## while len(y) != 0:
for XXX in x:
if y[0] != XXX:
group += (XXX,)
## print group, x
x = group
y = y[1:]
return x, y
This assignment called for four different code files: ps3a.py ps3b.py ps3c.py ps3d.py I have included all four in the code section. # Problem Set 3 (Problem 1) ps3a.py
# Name: Scott Brenner
# Collaborators: None
# Date: 2011-01-29
# Time: 2:45 PM
#
#!/usr/local/bin/python
from string import * # used for find()
# Problem 1.
# Write two functions, called countSubStringMatch and countSubStringMatchRecursive that take two arguments, a key string and a target string. These functions iteratively and recursively count the number of instances of the key in the target string. You should complete definitions for
# Targets and keys
target = "atgacatgcacaagtatgcat"
key = "atgc"
def countSubStringMatch(target,key):
"""This function returns the number of times a key string appears in target string. This function iterates through the taret string."""
count = 0
start = 0
while find(target, key, start) != -1:
count += 1
start = find(target, key, start) + 1
return count
def countSubStringMatchRecursive (target, key):
"""This function returns the number of times a key string appears in target string. This function uses recursion."""
answer = 0
next_match = find(target,key)
if next_match == -1:
return answer
else:
answer = 1 + countSubStringMatchRecursive(target[next_match+1:], key)
return answer
print countSubStringMatch(target,key)
print countSubStringMatchRecursive(target,key)
#*****************************************************
# Problem Set 3 (Problem 2) ps3b.py
# Name: Scott Brenner
# Collaborators: None
# Date: 2011-02-01
# Start Time: 11:29 AM
# End Time: 12:04 PM
# I reused code I had drafted earlier.
#!/usr/local/bin/python
from string import * # used for find()
# Problem 2.
# Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for
# def subStringMatchExact(target,key):
# For example, would return the tuple (5, 15). The file ps3_template.py includes some test strings that you can use to test your function. In particular, we provide two target strings and four key strings. Test your function on each combination of key and target string, as well as other examples that you create. Place your answer in a file named ps3b.py
# Targets and keys
target1 = 'atgacatgcacaagtatgcat'
target2 = 'atgaatgcatggatgtaaatgcag'
key10 = 'a'
key11 = 'atg'
key12 = 'atgc'
key13 = 'atgca'
def subStringMatchExact (target, key):
"""This function returns a tuple of the starting position(s) of a key string within a target string"""
answer_tuple = () # initialize the tuple we will return
start = 0 # use this initial the starting point for find()
while find(target, key, start) >=0:
start = find(target, key, start)
answer_tuple += (start,)
start+=1
return answer_tuple
#### Run Program with a variety of strings and keys ####
print "atgacatgcacaagtatgcat", "atgc"
print subStringMatchExact("atgacatgcacaagtatgcat", "atgc")
print target1, key10
print subStringMatchExact(target1, key10)
print target1, key11
print subStringMatchExact(target1, key11)
print target1, key12
print subStringMatchExact(target1, key12)
print target1, key13
print subStringMatchExact(target1, key13)
print target2, key10
print subStringMatchExact(target2, key10)
print target2, key11
print subStringMatchExact(target2, key11)
print target2, key12
print subStringMatchExact(target2, key12)
print target2, key13
print subStringMatchExact(target2,key13)
#*****************************************************
# Problem Set 3 (Problem 3) ps3c.py
# Name: Scott Brenner
# Collaborators: None
# Date: 2011-02-01
# Time: 11:29 AM
#
#!/usr/local/bin/python
from string import * # used for find()
# Problem 3.
# Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring. Complete the definition
# To test this function, we have provided a function called subStringMatchOneSub, which takes two arguments: a target string and a key string. This function will return a tuple of all starting points of matches of the key to the target, such that at most one element of the key is incorrectly matched to the target. This function is provided for you in the file ps3_template.py and invokes the function you are to write. Save your answers in a file named ps3c.py.
# these are some example strings for use in testing your code
# target strings
target1 = 'atgacatgcacaagtatgcat'
# 01234567890123456789
target2 = 'atgaatgcatggatgtaaatgcag'
# key strings
key10 = 'a'
key11 = 'atg' # matches in target1 == (0, 5, 15) length == 3
key12 = 'atgc' # matches in target1 == (5, 15)
key13 = 'atgca'
#### This is the method I defined. ####
def constrainedMatchPair(firstMatch,secondMatch,length):
"""This function takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring."""
answer = ()
for i in firstMatch:
for j in secondMatch:
if i + length + 1 == j:
answer += (i,)
return answer
#### This is the method I defined in the earlier problem. ####
def subStringMatchExact (target, key):
"""This function returns a tuple of the starting position(s) of a key string within a target string"""
answer_tuple = () # initialize the tuple we will return
start = 0 # use this initial the starting point for find()
while find(target, key, start) >=0:
start = find(target, key, start)
answer_tuple += (start,)
start+=1
return answer_tuple
### the following procedure you will use in Problem 3
def subStringMatchOneSub(key,target):
"""search for all locations of key in target, with one substitution"""
allAnswers = ()
for miss in range(0,len(key)):
# miss picks location for missing element
# key1 and key2 are substrings to match
key1 = key[:miss]
key2 = key[miss+1:]
print 'breaking key',key,'into',key1,key2
# match1 and match2 are tuples of locations of start of matches
# for each substring in target
match1 = subStringMatchExact(target,key1)
match2 = subStringMatchExact(target,key2)
# when we get here, we have two tuples of start points
# need to filter pairs to decide which are correct
filtered = constrainedMatchPair(match1,match2,len(key1))
allAnswers = allAnswers + filtered
print 'match1',match1
print 'match2',match2
print 'possible matches for',key1,key2,'start at',filtered
return allAnswers
print subStringMatchOneSub(key11,target1)
#*****************************************************
#!/usr/local/bin/python
# Problem Set 3 (Problem 4) ps3d.py
# Name: Scott Brenner
# Collaborators: None
# Date: 2011-02-01
# Time: 11:29 AM
#
# This was so hard to solve. I think it took over eight hours spread over a week. I kept getting stuck on how to remove the perfect matches from the tuple that was returned.
# If you remove the matches from the beginning of the tuple using positions, the positions, of course, shift. If you try to do it by matching the perfect matches to the entire realm of matches, you can't just rely on comparison of the perfect start to a member of the entire realm. You must test a conjunction of ALL perfect matches to the member of the entire realm. I couldn't get this to work. Instead I built a list of the positions of the perfect matches and then removed those elements from the answer tuple. The key was learning to iterate through a tuple backwards. That way removing an element did not alter the position of the elements yet to be removed.
from string import * # used for find()
# Problem 4
# Write a function, called subStringMatchExactlyOneSub which takes two arguments: a target string and a key string. This function should return a tuple of all starting points of matches of the key to the target, such that at exactly one element of the key is incorrectly matched to the target. Complete the definition. Save your answers in a file named ps3d.py.
target1 = 'atgacatgcacaagtatgcatatgacatgcacaagtatgcatatgacatgcacaagtatgcatatgacatgcacaagtatgcat'
# 01234567890123456789
target2 = 'atgaatgcatggatgtaaatgcag'
# key strings
key10 = 'a'
key11 = 'atg'
key12 = 'atgc'
key13 = 'atgca'
def subStringMatchExactlyOneSub(target,key):
"""
This function takes two arguments: a target string and a key string.
It returns a tuple of all starting points of matches of the key to the target, such that at exactly one element of the key is incorrectly matched to the target.
"""
possible_answer = subStringMatchOneSub(key,target)
answer = possible_answer
perfect_matches = subStringMatchExact(target,key)
to_remove_from_answer = ()
# this for loop identifies the positions in possible_answer that contain perfect matches.
for i in range(0,len(possible_answer)):
for j in range(0,len(perfect_matches)):
if possible_answer[i] == perfect_matches[j]:
#print "matches:", possible_answer[i]
to_remove_from_answer += (i,)
#print to_remove_from_answer
# this for loop removes the items from the possible_answer tuple begin at the end and working forward.
for m in reversed(to_remove_from_answer):
#print to_remove_from_answer[-m]
#print m
answer = answer[:m] + answer[m+1:]
# print answer
return answer
def constrainedMatchPair(firstMatch,secondMatch,length):
"""
This function takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring.
The function returns a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.
"""
answer = ()
for i in firstMatch:
for j in secondMatch:
if i + length + 1 == j:
answer += (i,)
return answer
def subStringMatchExact(target, key):
"""
This function returns a tuple of the starting position(s) of a key string within a target string.
"""
answer_tuple = () # initialize the tuple we will return
start = 0 # use this initial the starting point for find()
while find(target, key, start) >=0:
start = find(target, key, start)
answer_tuple += (start,)
start+=1
return answer_tuple
def subStringMatchOneSub(key,target):
"""
Search for all locations of key in target, with one substitution
"""
allAnswers = ()
for miss in range(0,len(key)):
# miss picks location for missing element
# key1 and key2 are substrings to match
key1 = key[:miss]
key2 = key[miss+1:]
#print 'breaking key',key,'into',key1,key2
# match1 and match2 are tuples of locations of start of matches
# for each substring in target
match1 = subStringMatchExact(target,key1)
match2 = subStringMatchExact(target,key2)
# when we get here, we have two tuples of start points
# need to filter pairs to decide which are correct
filtered = constrainedMatchPair(match1,match2,len(key1))
allAnswers = allAnswers + filtered
#print 'match1',match1
#print 'match2',match2
#print 'possible matches for',key1,key2,'start at',filtered
return allAnswers
#print subStringMatchOneSub(key12,target1)
print subStringMatchExactlyOneSub(target1,key11)
No comments. Sign up or log in to comment #Problem Set 3
#Name: Andrew
#Time: 12 hours
#Collaborators: Curious Reef
from string import *
# target strings
target1 = 'atgacatgcacaagtatgcat'
target2 = 'atgaatgcatggatgtaaatgcag'
# key strings
key10 = 'a'
key11 = 'atg'
key12 = 'atgc'
key13 = 'atgca'
#problem 1
def countSubStringMatch(target,key):
count = 0
for i in range(len(target)):
if find(target,key,i) == i:
count += 1
return count
def countSubStringMatchRecursive (target, key):
""" Recursively counts the number of times a term appears in a string"""
if find(target, key) != -1:
return 1 + countSubStringMatchRecursive(target[find(target, key)+1:], key)
return 0
#problem 2
def subStringMatchExact(target, key):
counts = ()
for i in range(len(target)):
if find(target,key,i) == i:
counts += i,
return counts
#problem 3
def constrainedMatchPair(firstMatch, secondMatch, length):
places = ()
for i in firstMatch:
for j in secondMatch:
if i + length + 1 == j:
places += (i,)
return places
def subStringMatchOneSub(key,target):
"""search for all locations of key in target, with one substitution"""
allAnswers = ()
print 'target:',target
print 'key:',key
print ''
for miss in range(0,len(key)):
# miss picks location for missing element
# key1 and key2 are substrings to match
key1 = key[:miss]
key2 = key[miss+1:]
print 'breaking key','\''+key+'\'','into','key1: '+'\''+key1+'\''+' and key2: '+'\''+key2+'\''
# match1 and match2 are tuples of locations of start of matches
# for each substring in target
match1 = subStringMatchExact(target,key1)
match2 = subStringMatchExact(target,key2)
# when we get here, we have two tuples of start points
# need to filter pairs to decide which are correct
filtered = constrainedMatchPair(match1,match2,len(key1))
print 'here is filtered:',filtered
allAnswers = allAnswers + filtered
print 'match1:',match1
print 'match2:',match2
print 'possible matches for',key1,key2,'start at',filtered
print ''
return allAnswers
#problem 4
def subStringMatchExactlyOneSub(key, target):
"""search for all locations of key in target, with one substitution"""
allAnswers = ()
print 'target:',target
print 'key:',key
print ''
for miss in range(0,len(key)):
# miss picks location for missing element
# key1 and key2 are substrings to match
key1 = key[:miss]
key2 = key[miss+1:]
print 'breaking key','\''+key+'\'','into','key1: '+'\''+key1+'\''+' and key2: '+'\''+key2+'\''
# match1 and match2 are tuples of locations of start of matches
# for each substring in target
match1 = subStringMatchExact(target,key1)
match2 = subStringMatchExact(target,key2)
# when we get here, we have two tuples of start points
# need to filter pairs to decide which are correct
filtered = constrainedMatchPair(match1,match2,len(key1))
cache = ()
for i in filtered:
if i not in subStringMatchExact(target,key):
cache += i,
del filtered
filtered = ()
filtered = cache
allAnswers = allAnswers + filtered
print 'match1:',match1
print 'match2:',match2
print 'possible matches for',key1,key2,'start at',filtered
print ''
return allAnswers
##if __name__ == "__main__":
## main()
No comments. Sign up or log in to comment No comments. Sign up or log in to comment The recursive function was really making me mad, Still didn't quite get it as I couldn't get it to return the proper statement that I wanted. from string import *
# this is a code file that you can use as a template for submitting your
# solutions
# these are some example strings for use in testing your code
# target strings
target1 = 'atgacatgcacaagtatgcat'
target2 = 'atgaatgcatggatgtaaatgcag'
# key strings
key10 = 'a'
key11 = 'atg'
key12 = 'atgc'
key13 = 'atgca'
### the following procedure you will use in Problem 3
def subStringMatchOneSub(key,target):
"""search for all locations of key in target, with one substitution"""
allAnswers = ()
for miss in range(0,len(key)):
# miss picks location for missing element
# key1 and key2 are substrings to match
key1 = key[:miss]
key2 = key[miss+1:]
##print 'breaking key',key,'into',key1,key2
# match1 and match2 are tuples of locations of start of matches
# for each substring in target
match1 = subStringMatchExact(target,key1)
match2 = subStringMatchExact(target,key2)
# when we get here, we have two tuples of start points
# need to filter pairs to decide which are correct
filtered = constrainedMatchPair(match1,match2,len(key1))
allAnswers = allAnswers + filtered
##print 'match1',match1
##print 'match2',match2
##print 'possible matches for',key1,key2,'start at',filtered
return allAnswers
# Problem 1
def countSubStringMatch(target,key):
"""counts number of times key appears withing the target"""
count = 0
for i in range(0,len(target)):
sequence = find(target,key,i,i+len(key))
if sequence != -1:
count += 1
print key, 'occurs', count, 'times in the string', target
def countSubStringMatchRecursive(target,key, count = 0):
"""Counts the number of times a key appears within the target"""
index = rfind(target,key)
if index != -1:
count += 1
countSubStringMatchRecursive(target[:-len(target)+index],key,count)
else:
print key, 'occurs', count, 'times'
# Problem 2
def subStringMatchExact(target,key):
"""returns tuple with locations where key appears within target"""
startPoint = []
for i in range(0,len(target)):
sequence = find(target,key,i,i+len(key))
if sequence != -1:
startPoint.append(sequence)
return tuple(startPoint)
# Problem 3
def constrainedMatchPair(firstMatch,secondMatch,length):
"""returns a tuple of locations in firstMatch + length + 1 == secondMatch"""
matchPair = []
for k in secondMatch:
for n in firstMatch:
if n + length + 1 == k:
matchPair.append(n)
elif n + length == k and firstMatch[-1] == k and len(secondMatch) == len(firstMatch):
matchPair.append(n)
return tuple(matchPair)
# Problem 4
def subStringMatchExactlyOneSub(target,key):
""" returns all locations of key in target, with exactly one substitution"""
exact = subStringMatchExact(target,key)
oneSub = subStringMatchOneSub(key,target)
exactlyOneSub = list(oneSub)
for match in exact:
for one in oneSub:
if match == one:
exactlyOneSub.remove(match)
return tuple(exactlyOneSub)
No comments. Sign up or log in to comment ##Problem Set 3
## Name: Jimmy
## Time: 15:00
from string import *
target1 = 'atgacatgcacaagtatgcat'
target2 = 'atgaatgcatggatgtaaatgcag'
targets = (target1, target2)
key10 = 'a'
key11 = 'atg'
key12 = 'atgc'
key13 = 'atgca'
keys = (key10, key11, key12, key13)
def subStringMatchOneSub(key,target):
"""search for all locations of key in target, with one substitution"""
allAnswers = ()
for miss in range(0,len(key)):
key1 = key[:miss]
key2 = key[miss+1:]
match1 = subStringMatchExact(target,key1)
match2 = subStringMatchExact(target,key2)
filtered = constrainedMatchPair(match1,match2,len(key1))
allAnswers = allAnswers + filtered
return allAnswers
## problem 3a
def countSubStringMatch(target,key):
counter = [-1]
tryrange = range(0, len(target) + 1)
for x in tryrange:
location = find(target, key, x)
if location not in counter:
counter.append(location)
if counter == -1:
return 0
else:
counter.remove(-1)
return len(counter)
def helpcountSubStringMatchRecursive(target, key, incr, counter):
position = find(target, key, incr)
incr += 1
if position not in counter:
counter.append(position)
helpcountSubStringMatchRecursive(target, key, incr, counter)
if incr -1 >= len(target):
return counter
else:
helpcountSubStringMatchRecursive(target, key, incr, counter)
def countSubStringMatchRecursive(target, key):
counter = [-1]
helpcountSubStringMatchRecursive(target, key, 0, counter)
counter.remove(-1)
return len(counter)
## problem 3b
def subStringMatchExact(target,key):
counter = [-1]
tryrange = range(0, len(target) + 1)
for x in tryrange:
location = find(target, key, x)
if location not in counter:
counter.append(location)
if counter == -1:
return 0
else:
counter.remove(-1)
return tuple(counter)
## problem 3c
def constrainedMatchPair(firstMatch, secondMatch, length):
matches = []
for n in firstMatch:
for k in secondMatch:
m = length
if n + m + 1 == k:
matches.append(n)
return tuple(matches)
## problem 3d
def subStringMatchExactlyOneSub(target,key):
exact = subStringMatchExact(target,key)
close = subStringMatchOneSub(key,target)
onesub = []
for index in close:
if index not in exact:
onesub.append(index)
return tuple(onesub)
No comments. Sign up or log in to comment # Problem Set 3, Problem 1
# Name: Ariel Mamani
# Collaborators:
# Time: 10:30 #
from string import *
target1 = 'atgacatgcacaagtatgcat'
target2 = 'atgaatgcatggatgtaaatgcag'
# key strings
key10 = 'a'
key11 = 'atg'
key12 = 'atgc'
key13 = 'atgca'
def countSubStringMatch(target,key):
i=0
c=0
while(i+len(key)<len(target)):
s=target[i:i+len(key)]
if(s==key):
c+=1
i=i+len(key)
else:
i=i+1
return c
def countSubStringMatchRecursive(target,key):
if(len(target)<len(key)):
return 0
if(len(target)==len(key)):
if(target==key):
return 1
else:
return 0
else:
s=target[0:len(key)]
if(s==key):
return countSubStringMatchRecursive(target[len(key):],key)+1
else:
return countSubStringMatchRecursive(target[1:],key)
print countSubStringMatch(target1,key13)
print countSubStringMatch(target1,key12)
print countSubStringMatch(target1,key11)
# Problem Set 3, Problem 2
# Name: Ariel Mamani
# Collaborators:
# Time: 10:30 #
from string import *
target1 = 'atgacatgcacaagtatgcat'
target2 = 'atgaatgcatggatgtaaatgcag'
# key strings
key10 = 'a'
key11 = 'atg'
key12 = 'atgc'
key13 = 'atgca'
def subStringMatchExact(target,key):
t=[]
encontrado=find(target,key)
while encontrado!=-1:
t.append(encontrado)
encontrado=find(target,key,encontrado+1)
return tuple(t)
print subStringMatchExact(target1,key12)
print subStringMatchExact(target1,key13)
# Problem Set 3, Problem 3
# Name: Ariel Mamani
# Collaborators:
# Time: #
from string import *
# this is a code file that you can use as a template for submitting your
# solutions
# these are some example strings for use in testing your code
# target strings
target1 = 'atgacatgcacaagtatgcat'
target2 = 'atgaatgcatggatgtaaatgcag'
# key strings
key10 = 'a'
key11 = 'atg'
key12 = 'atgc'
key13 = 'atgca'
def subStringMatchExact(target,key):
t=[]
encontrado=find(target,key)
while encontrado!=-1:
t.append(encontrado)
encontrado=find(target,key,encontrado+1)
return tuple(t)
def constrainedMatchPair(firstMatch, secondMatch, length):
res = []
for r1 in firstMatch:
for r2 in secondMatch:
if r1 + length + 1 == r2:
res.append(r1)
return res
### the following procedure you will use in Problem 3
def subStringMatchOneSub(key,target):
"""search for all locations of key in target, with one substitution"""
allAnswers = ()
for miss in range(0,len(key)):
# miss picks location for missing element
# key1 and key2 are substrings to match
key1 = key[:miss]
key2 = key[miss+1:]
print 'breaking key',key,'into',key1,key2
# match1 and match2 are tuples of locations of start of matches
# for each substring in target
match1 = subStringMatchExact(target,key1)
match2 = subStringMatchExact(target,key2)
# when we get here, we have two tuples of start points
# need to filter pairs to decide which are correct
filtered = constrainedMatchPair(match1,match2,len(key1))
allAnswers = allAnswers + tuple(filtered)
print 'match1',match1
print 'match2',match2
print 'possible matches for',key1,key2,'start at',filtered
return allAnswers
print subStringMatchOneSub(key10,target1)
print subStringMatchOneSub(key11,target1)
print subStringMatchOneSub(key12,target1)
print subStringMatchOneSub(key13,target1)
print subStringMatchOneSub(key10,target2)
print subStringMatchOneSub(key11,target2)
print subStringMatchOneSub(key12,target2)
print subStringMatchOneSub(key13,target2)
# Problem Set 3, Problem 4
# Name: Ariel Mamani
# Collaborators:
# Time: #
from string import *
# target strings
target1 = 'atgacatgcacaagtatgcat'
target2 = 'atgaatgcatggatgtaaatgcag'
# key strings
key10 = 'a'
key11 = 'atg'
key12 = 'atgc'
key13 = 'atgca'
def subStringMatchExact(target,key):
t=[]
encontrado=find(target,key)
while encontrado!=-1:
t.append(encontrado)
encontrado=find(target,key,encontrado+1)
return tuple(t)
def constrainedMatchPair(firstMatch, secondMatch, length):
res = []
for r1 in firstMatch:
for r2 in secondMatch:
if r1 + length + 1 == r2:
res.append(r1)
return res
def subStringMatchOneSub(key,target):
"""search for all locations of key in target, with one substitution"""
allAnswers = ()
for miss in range(0,len(key)):
# miss picks location for missing element
# key1 and key2 are substrings to match
key1 = key[:miss]
key2 = key[miss+1:]
#print 'breaking key',key,'into',key1,key2
# match1 and match2 are tuples of locations of start of matches
# for each substring in target
match1 = subStringMatchExact(target,key1)
match2 = subStringMatchExact(target,key2)
# when we get here, we have two tuples of start points
# need to filter pairs to decide which are correct
filtered = constrainedMatchPair(match1,match2,len(key1))
allAnswers = allAnswers + tuple(filtered)
#print 'match1',match1
#print 'match2',match2
#print 'possible matches for',key1,key2,'start at',filtered
return allAnswers
def subStringMatchExactlyOneSub(target,key):
exacto = set(subStringMatchExact(target,key))
#print exacto
soloUno = set(subStringMatchOneSub(key,target))
#print soloUno
resultado=soloUno-exacto
#print resultado
return tuple(resultado)
print subStringMatchExactlyOneSub(target2,key13)
No comments. Sign up or log in to comment from string import * def subStringMatchExact(target,key): i=0 c=0 tup=() while c!=-1: c = find(target,key,i) if c!=-1: tup = tup + (c,) i=c+1 return tup def subStringMatchOneSub1(target,key): length=len(key) for i in range(0,length): key1=key[0:i] key2=key[i+1:length] starts1=subStringMatch(target,key1) starts2=subStringMatch(target,key2) print starts1, starts2 def constrainedMatchPair(firstMatch,secondMatch,length): tup=() m=len(secondMatch) lenfirst=len(firstMatch) lensecond=len(secondMatch) for n in range(0,lenfirst): for k in range(0,lensecond): if firstMatch[n]+m+1 == secondMatch[k]: tup = tup +(n,) return tup def subStringMatchOneSub(target,key): """search for all locations of key in target, with one substitution""" allAnswers = () for miss in range(0,len(key)): # miss picks location for missing element # key1 and key2 are substrings to match key1 = key[:miss] key2 = key[miss+1:] print 'breaking key',key,'into',key1,key2 # match1 and match2 are tuples of locations of start of matches # for each substring in target match1 = subStringMatchExact(target,key1) match2 = subStringMatchExact(target,key2) #print match1,match2 # when we get here, we have two tuples of start points # need to filter pairs to decide which are correct filtered = constrainedMatchPair(match1,match2,len(key1)) allAnswers = allAnswers + filtered print 'match1',match1 print 'match2',match2 print 'possible matches for',key1,key2,'start at',filtered return allAnswers #def subStringMatchExactlyOneSub(target,key): No comments. Sign up or log in to comment pset3 from string import *
##Target Strings
target1 = 'atgacatgcacaagtatgcat'
target2 = 'atgaatgcatggatgtaaatgcag'
##Key Strings
key10 = 'a'
key11 = 'atg'
key12 = 'atgc'
key13 = 'atgca'
##Problem 1
def countSubStringMatch(key,target):
"""This function returns the number of instances of the key in the target string"""
counter = 0 ##Set the counter to 0
start = 0 ##Set the starting place in the string to 0
while find(key,target,start) >=0:
counter += 1 ##Add one to the counter when a match is found
start = find(key,target,start) + 1 ##Change the starting place to the next character in the string
return counter ##Return the final counter
def countSubStringMatchRecursive(target,key):
"""This function returns the number of instances of the key in the target string."""
first = find(target,key) ##Find the first instance of the target string.
if first == -1: ##Exit if there is no instance of the key.
return 0
else:
return 1 + countSubStringMatch(target[first+1:-1],key) ##Return the result of the function with the new slice of the string.
##Problem 2
def subStringMatchExact(target,key):
start = 0 ##Set the starting point to 0
point = [] ##Initialize the list to hold the starting points
while find(target,key,start) >= 0:
point.append(find(target,key,start)) ##Add the starting point to the list
start = find(target,key,start) + 1 ##Find the new starting place in the target string
answertuple = tuple(point) ##Change the answer to a tuple
return answertuple ##Return the tuple
#Problem 3
def subStringMatchOneSub(key,target): # this function was provided by the instructor
"""search for all locations of key in target, with one substitution"""
allAnswers = ()
for miss in range(0,len(key)):
# miss picks location for missing element
# key1 and key2 are substrings to match
key1 = key[:miss]
key2 = key[miss+1:]
print 'breaking key',key,'into',key1,key2
# match1 and match2 are tuples of locations of start of matches
# for each substring in target
match1 = subStringMatchExact(target,key1)
match2 = subStringMatchExact(target,key2)
# when we get here, we have two tuples of start points
# need to filter pairs to decide which are correct
filtered = constrainedMatchPair(match1,match2,len(key1))
allAnswers = allAnswers + filtered
print 'match1',match1
print 'match2',match2
print 'possible matches for',key1,key2,'start at',filtered
return allAnswers
def constrainedMatchPair(firstMatch,secondMatch,length):
match = [] ##Create the list to keep track of the matches
for i in range(0,len(firstMatch)): ##Test if they match up
for j in range(0,len(secondMatch)):
if secondMatch[j] == firstMatch[i] + length + 1:
match.append(firstMatch[i])
break
matchestuple = tuple(match)
return matchestuple
def subStringMatchExactlyOneSub(target,key):
exactmatch = subStringMatchExact(target,key)
allmatch = subStringMatchOneSub(key,target)
output = []
for i in range(0,len(allmatch)):
check = 0
for j in range(0, len(exactmatch)):
if exactmatch[j] == allmatch[i]:
check = 1
break
if check == 0:
output.append(allmatch[i])
outputtuple = tuple(output)
return outputtuple
No comments. Sign up or log in to comment # Problem Set 3
# Name: Fredrik Gustafsson
# Python version: 3.2
# Time: 3:00
##
## Problem 3a
##
def countSubStringMatch(target, key):
"""Takes a target and a key and returns an ingeger number of instances of key in target"""
assert type(target) == str, 'target must be of type string, NOT of type:' + str(type(target))
assert type(key) == str, 'key must be of type string, NOT of type:' + str(type(key))
x = 0
ctr = 0
while x in range(len(target)):
y = str.find(target, key, x)
if y != -1:
x = y + len(key)
ctr += 1
else:
return ctr
def countSubStringMatchRecursive (target, key):
"""Takes a target and a key and returns an integer number of instances of key in target"""
assert type(target) == str, 'target must be of type string, NOT of type:' + str(type(target))
assert type(key) == str, 'key must be of type string, NOT of type:' + str(type(key))
y = str.find(target, key)
if y != -1:
ctr = countSubStringMatchRecursive(target[y+len(key):], key)
else:
ctr = 0
return ctr
return ctr + 1
##
## Problem 3b
##
def subStringMatchExact(target, key):
"""Takes a target and a key and returns A TUPLE of the starting position
of matches of the key string in the target strign"""
assert type(target) == str, 'target must be of type string, NOT of type:' + str(type(target))
assert type(key) == str, 'key must be of type string, NOT of type:' + str(type(key))
ls = []
x = 0
while x in range(len(target)):
y = str.find(target, key, x)
if y != -1:
if len(key) == 0:
x += 1
else:
x = y + len(key)
ls.append (y)
else:
return tuple(ls)
##
## Problem 3c
##
def constrainedMatchPair(firstMatch,secondMatch,length):
"""Takes two tuples of startingpoints and the length of the first keyword,
and returns a tuple of all the members of n in k so that (n + length + 1 = k)"""
if firstMatch != None:
assert type(firstMatch) == tuple, 'firstMatch must be of type tuple, NOT of type:' + str(type(firstMatch))
if secondMatch != None:
assert type(secondMatch) == tuple, 'secondMatch must be of type tuple, NOT of type:' + str(type(secondMatch))
assert type(length) == int, 'length of the first strign must be of type int, NOT of type:' + str(type(length))
if firstMatch == None: return secondMatch
if secondMatch == None: return tuple(firstMatch)
x = 0
z = []
while x in range(len(firstMatch)):
y = 0
while y in range(len(secondMatch)):
if (firstMatch[x] + length + 1) == secondMatch[y]:
z.append(firstMatch[x])
y += 1
x += 1
return tuple(z)
##
## Problem 3d
##
def subStringMatchExactlyOneSub(target,key):
""" """
assert type(target) == str, 'target must be of type string, NOT of type' + str(type(target))
assert type(key) == str, 'key must be of type string, NOT of type' + str(type(key))
# First step splits the key into two lists
string1 = []
string2 = []
x = 1
while x in range(len(key)+1):
string1.append(key[:x-1])
string2.append(key[x:])
x += 1
# Searches for matches between the strings in the two tuples and the target
match1 = []
match2 = []
x = 0
while x in range(len(string1)):
match1.append(subStringMatchExact(target, string1[x]))
match2.append(subStringMatchExact(target, string2[x]))
x += 1
# Searches for members of match1 that satisfy match1[x] + len(string1 in match1[x]) + 1 = match2[x]
member = []
x = 0
while x in range(len(string1)):
member.append(constrainedMatchPair(match1[x], match2[x], len(string1[x])))
x += 1
# Sorts and removes duplicate
a = []
for x in range(len(member)):
z = member[x]
for y in range(len(z)):
if z[y] not in a:
a.append(z[y])
a.sort()
return tuple(a)
No comments. Sign up or log in to comment from string import *
#=============== Probelm 1 =====================
def countSubStringMatch(target,key):
count = 0
matchFound = find(target,key)
while matchFound != -1:
matchFound = find(target,key,matchFound+1)
if matchFound != -1:
count = count + 1
return count
def testCountSubStringMatch():
target= "atgacatgcacaagtatgcat"
key = "atg"
countSubStringMatch(target,key)
def countSubStringMatchRecursive(target, key):
global counter
matchFound = find(target,key)
if matchFound != -1:
counter +=1
return countSubStringMatchRecursive(target[matchFound + 1 :], key)
else:
return counter
counter = 0
def testCountSubSringMatchRecursive():
target= "atgacatgcacaagtatgcatcatcatjgjgcatjjgvjcatjjbjcat"
key = "cat"
countSubStringMatchRecursive(target,key)
#============= Problem2 ================== =======
def subStringMatchExact(target,key):
matchFound =[]
match = find(target,key)
while match != -1:
matchFound.append(match)
match = find(target,key, match + 1)
return tuple(matchFound)
def testSubStringMatchExact():
# target strings
target1 = 'atgacatgcacaagtatgcat'
target2 = 'atgaatgcatggatgtaaatgcag'
# key strings
key10 = 'a'
key11 = 'atg'
key12 = 'atgc'
key13 = 'atgca'
# test
print "test1"
print subStringMatchExact('atgacatgcacaagtatgcat','atg')
print "test2"
print subStringMatchExact(target1,key11)
print "test3"
print subStringMatchExact(target1,key12)
print "test4"
print subStringMatchExact(target1,key13)
print "test5"
print subStringMatchExact(target2,key10)
print "test6"
print subStringMatchExact(target2,key11)
print "test6"
print subStringMatchExact(target2,key12)
print "test8"
print subStringMatchExact(target2,key13)
#================= Problem 3 =====================
target1 = 'atgacatgcacaagtatgcat'
target2 = 'atgaatgcatggatgtaaatgcag'
# key strings
key10 = 'a'
key11 = 'atg'
key12 = 'atgc'
key13 = 'atgca'
def constrainedMatchPair(firstMatch, secondMatch, length):
results = []
for ans in firstMatch:
for ans1 in secondMatch:
if ans + length + 1 == ans1:
results.append(ans)
return tuple(results)
### the following procedure you will use in Problem 3
def subStringMatchOneSub(key,target):
"""search for all locations of key in target, with one substitution"""
allAnswers = ()
for miss in range(0,len(key)):
# miss picks location for missing element
# key1 and key2 are substrings to match
key1 = key[:miss]
key2 = key[miss+1:]
#print 'breaking key',key,'into',key1,key2
# match1 and match2 are tuples of locations of start of matches
# for each substring in target
match1 = subStringMatchExact(target,key1)
match2 = subStringMatchExact(target,key2)
# when we get here, we have two tuples of start points
# need to filter pairs to decide which are correct
filtered = constrainedMatchPair(match1,match2,len(key1))
allAnswers = allAnswers + filtered
#print 'match1',match1
#print 'match2',match2
#print 'possible matches for',key1,key2,'start at',filtered
return allAnswers
#================== Problem 4 ================
def subStringMatchExactlyOneSub(target,key):
result = []
# One way of fiding the answer is with Sets
#exactMatches = set(subStringMatchExact(target,key))
#upToOneMatches = set(subStringMatchOneSub(key,target))
#return tuple(upToOneMatches - exactMatches )
# Second way
exactMatches = subStringMatchExact(target,key)
upToOneMatches = subStringMatchOneSub(key,target)
for ans in upToOneMatches:
if ans not in exactMatches:
result.append(ans)
print tuple(result)
No comments. Sign up or log in to comment #!/usr/bin/env python
#encoding=utf-8
from string import *
# this is a code file that you can use as a template for submitting your
# solutions
# these are some example strings for use in testing your code
# target strings
target1 = 'atgacatgcacaagtatgcat'
target2 = 'atgaatgcatggatgtaaatgcag'
# key strings
key10 = 'a'
key11 = 'atg'
key12 = 'atgc'
key13 = 'atgca'
def countSubStringMatch(targetstring,substring):
"""count ocurrences of substring in targetstring iteratively"""
if type(targetstring) != type(str()) or type(substring) != type(str()) :# type checking (both arguments should be strings)
return -1 # this indicates an error
count = 0
primeiro = find(targetstring, substring)
if primeiro == -1:
print targetstring, "não tem", substring
return -1
else:
while primeiro != -1:
count += 1
proximo = primeiro + 1
primeiro = find(targetstring, substring, proximo)
print targetstring, "contém", count, substring
def countSubstringMatchRecursive(targetstring, keystring, count=0):
"""count ocurrences of substring in targetstring recursively.
The count variable serves to keep track of the instances of the
string through the recursion, and is essentially intialized externally by
setting it to 0 above.
This function should be called with 'print' """
#if type(targetstring) != type(str()) or type(keystring) != type(str()) :# type checking (both arguments should be strings)
# return -1 # this indicates an error
primeiro = find(targetstring, keystring)
if primeiro != -1:
proximo = primeiro + 1
resultado = 1 + countSubstringMatchRecursive(targetstring[proximo:], keystring)
print resultado
return resultado
else:
print 'não há', keystring, 'em', targetstring
return 0 #Base case (targetstring==keystring).
#=====================end of ps3a.py============
# target strings
target1 = 'atgacatgcacaagtatgcat'
target2 = 'atgaatgcatggatgtaaatgcag'
# key strings
key10 = 'a'
key11 = 'atg'
key12 = 'atgc'
key13 = 'atgca'
def subStringMatchExact(targetstring, substring):
"""returns a tuple of the starting points of matches of the key string in the target
string, when indexing starts at 0"""
if type(targetstring) != type(str()) or type(substring) != type(str()) :# type checking (both arguments should be strings)
return -1 # this indicates an error
posicao = ()
count = 0
primeiro = find(targetstring, substring)
if primeiro == -1:
print targetstring, "não tem", substring
return -1
else:
while primeiro != -1:
count += 1
proximo = primeiro + 1
posicao = posicao + (primeiro,)
primeiro = find(targetstring, substring, proximo)
print targetstring, "contém", count, substring, 'nas posições: ', posicao
subStringMatchExact(target2, key10)
subStringMatchExact(target2, key11)
subStringMatchExact(target2, key12)
subStringMatchExact(target2, key13)
subStringMatchExact(target1, key10)
subStringMatchExact(target1, key11)
subStringMatchExact(target1, key12)
subStringMatchExact(target1, key13)
#===========================end of ps3b.py==============
target1 = 'atgacatgcacaagtatgcat'
target2 = 'atgaatgcatggatgtaaatgcag'
# key strings
key10 = 'a'
key11 = 'atg'
key12 = 'atgc'
key13 = 'atgca'
def subStringMatchExact(targetstring, substring):
"""returns a tuple of the starting points of matches of the key string in the target
string, when indexing starts at 0"""
if type(targetstring) != type(str()) or type(substring) != type(str()) :# type checking (both arguments should be strings)
return -1 # this indicates an error
posicao = ()
count = 0
primeiro = find(targetstring, substring)
if primeiro == -1:
print targetstring, "não tem", substring
return -1
else:
while primeiro != -1:
count += 1
proximo = primeiro + 1
posicao = posicao + (primeiro,)
primeiro = find(targetstring, substring, proximo)
return posicao
def constrainedMatchPair(FirstMatch, SecondMatch, Length):
"""filters which combinations of subkeys are possible near-matches in targetstring"""
NearMatch = ()
for n in FirstMatch:
for k in SecondMatch:
if n + Length+ 1 == k:
NearMatch += (n,)
else:
pass
return NearMatch
### the following procedure you will use in Problem 3
def subStringMatchOneSub(key,target):
"""search for all locations of key in target, with one substitution"""
allAnswers = ()
for miss in range(0,len(key)):
# miss picks location for missing element
# key1 and key2 are substrings to match
key1 = key[:miss]
key2 = key[miss+1:]
print 'breaking key',key,'into',key1,'&', key2
# match1 and match2 are tuples of locations of start of matches
# for each substring in target
match1 = subStringMatchExact(target,key1)
match2 = subStringMatchExact(target,key2)
# when we get here, we have two tuples of start points
# need to filter pairs to decide which are correct
filtered = constrainedMatchPair(match1,match2,len(key1))#fc que preciso escrever - na verdade é só o filtro!!
allAnswers = allAnswers + filtered
print 'match1',match1
print 'match2',match2
print 'possible matches for',key1,key2,'start at',filtered
return allAnswers
subStringMatchOneSub(key10, target2)
subStringMatchOneSub(key11, target2)
subStringMatchOneSub(key12, target2)
subStringMatchOneSub(key13, target2)
subStringMatchOneSub(key10, target1)
subStringMatchOneSub(key11, target1)
subStringMatchOneSub(key12, target1)
subStringMatchOneSub(key13, target1)
#match1 = 0, 4, 8, 12, 18
#match2 = 7, 21
#print constrainedMatchPair(match1, match2, len('a'))
#=================end of ps3c.py==============
target1 = 'atgacatgcacaagtatgcat'
target2 = 'atgaatgcatggatgtaaatgcag'
# key strings
key10 = 'a'
key11 = 'atg'
key12 = 'atgc'
key13 = 'atgca'
def subStringMatchExact(targetstring, substring):
"""returns a tuple of the starting points of matches of the key string in the target
string, when indexing starts at 0"""
posicao = ()
count = 0
primeiro = find(targetstring, substring)
if primeiro == -1:
#print targetstring, "não tem", substring
return ()
else:
while primeiro != -1:
count += 1
proximo = primeiro + 1
posicao = posicao + (primeiro,)
primeiro = find(targetstring, substring, proximo)
#print posicao
return posicao
def constrainedMatchPair(FirstMatch, SecondMatch, Length):
"""filters which combinations of subkeys are possible near-matches in targetstring"""
NearMatch = ()
for n in FirstMatch:
for k in SecondMatch:
if n + Length+ 1 == k:
NearMatch += (n,)
else:
pass
return NearMatch
def subStringMatchOneSub(target,key):
"""search for all locations of key in target, with one substitution"""
allAnswers = ()
for miss in range(0,len(key)):
# miss picks location for missing element
# key1 and key2 are substrings to match
key1 = key[:miss]
key2 = key[miss+1:]
#print 'breaking key',key,'into',key1,'&', key2
# match1 and match2 are tuples of locations of start of matches
# for each substring in target
match1 = subStringMatchExact(target,key1)
match2 = subStringMatchExact(target,key2)
# when we get here, we have two tuples of start points
# need to filter pairs to decide which are correct
filtered = constrainedMatchPair(match1,match2,len(key1))#fc que preciso escrever - na verdade é só o filtro!!
allAnswers = allAnswers + filtered
#print 'match1',match1
#print 'match2',match2
#print 'possible matches for','"',key1,'"', '&', '"',str(key2),'"','start at',filtered
#print allAnswers
return allAnswers
def subStringMatchExactlyOneSub(target,key):
"""returns a tuple of all starting points of matches of the key to target
with exactly one substitution"""
PerfectMatches = subStringMatchExact(target, key)
NearMatches = subStringMatchOneSub(target, key)
results = ()
all = PerfectMatches + NearMatches
for member in set(all):
results += (member,)
print results
return results
#subStringMatchExactlyOneSub(target2, key13)
#subStringMatchOneSub(target2, key13)
#subStringMatchExactlyOneSub(target2, key11)
#subStringMatchOneSub(target2, key11)
#subStringMatchOneSub(target2, key12)
#subStringMatchExact(target2, key12)
#subStringMatchExactlyOneSub(target2, key12)
#print subStringMatchExact(target2, key13)
#subStringMatchOneSub(target2, key13)
#subStringMatchExact(target2, key13)
subStringMatchExactlyOneSub(target2, key13)
#subStringMatchExactlyOneSub(target2, key13)
#subStringMatchExactlyOneSub(target1, key10)
#subStringMatchExactlyOneSub(target1, key11)
#subStringMatchExactlyOneSub(target1, key12)
#subStringMatchExactlyOneSub(target1, key13)
#=========================end of ps3d.py==============
No comments. Sign up or log in to comment # Name: Waz
#Problem set 3
_______Problem 1__________
from string import*
def countSubStringMatch(target,key):
counter =0
whurr = find(target,key)
while whurr!= -1:
counter += 1
whurr = find(target, key, whurr+1)
return counter
_______Problem 2_____________
from string import*
def countSubStringMatchExact(target,key):
stpoints = ()
whurr = find(target,key)
while whurr!= -1:
stpoints += (whurr,)
whurr = find(target, key, whurr+1)
return stpoints
_________Problem 3_____________
def constrainedMatchPair(firstMatch,secondMatch,length):
result = ()
for n in firstMatch:
for k in secondMatch:
if n + length+ 1 == k:
result += (n,)
return result
_________Problem 4___________
def subStringMatchOneSub(key,target):
"""search for all locations of key in target, with one substitution"""
allAnswers = ()
for miss in range(0,len(key)):
# miss picks location for missing element
# key1 and key2 are substrings to match
key1 = key[:miss]
key2 = key[miss+1:]
print 'breaking key',key,'into',key1,key2
# match1 and match2 are tuples of locations of start of matches
# for each substring in target
match1 = subStringMatchExact(target,key1)
match2 = subStringMatchExact(target,key2)
# when we get here, we have two tuples of start points
# need to filter pairs to decide which are correct
filtered = constrainedMatchPair(match1,match2,len(key1))
allAnswers = allAnswers + filtered
print 'match1',match1
print 'match2',match2
print 'possible matches for',key1,key2,'start at',filtered
return allAnswers
No comments. Sign up or log in to comment #Problem Set 3
#Name: conwayblue
from string import *
target1 = 'atgacatgcacaagtatgcat'
target2 = 'atgaatgcatggatgtaaatgcag'
key10 = 'a'
key11 = 'atg'
key12 = 'atgc'
key13 = 'atgca'
#Problem 1 - Iterative----------------------------------------------
def countSubStringMatch(target,key):
"""Counts the number of key strings in target string - Incremental"""
count = 0 #Initialize count
position = -1 #Initialize position at -1 to start at index 0
while True:
position = find(target,key,position+1) #Find index of 1st key in target
if position == -1: #Test if None
break
count += 1 #Increase count
return count
#Problem 1 - Recursive-----------------------------------------------
def countSubStringMatchRecursive(target,key):
"""Counts the number of key strings in target string - Recursive"""
count = 0 #Initialize count
position = find(target,key) #Find initial
if position == -1: #Test if None
return count
else:
count += 1 #Increase count
return count + countSubStringMatchRecursive(target[position+1:],key) #Add count to count from recursion at last position + 1
#Problem 1a - Recursive-----------------------------------------------
def countSubStringMatchRecursive2(target,key):
"""Counts the number of key strings in target string - Recursive"""
if find(target,key) == -1: return 0
return 1 + countSubStringMatchRecursive(target[find(target,key)+1:],key)
#Problem 2 --------------------------------------------------------------
def subStringMatchExact(target,key):
"""Returns a tuple of index locations of each key in target"""
answers = []
position = -1
while True:
position = find(target,key,position+1)
if position == -1:
break
answers.append(position)
return tuple(answers)
#Problem 3---------------------------------------------------------------
def constrainedMatchPair(firstMatch,secondMatch,length):
"""Returns a tuple of indexes from firstMatch that are possible matches given indexes of secondMatch and length of key"""
##firstIndex + length + 1 = secondIndex
##secondIndex - firstIndex - length = 1
n = []
for firstIndex in firstMatch:
for secondIndex in secondMatch:
if secondIndex - firstIndex - length == 1:
n.append(firstIndex)
return tuple(n)
#function from problem sheet-
def subStringMatchOneSub(key,target):
"""search for all locations of key in target, with one substitution"""
allAnswers = ()
for miss in range(0,len(key)):
# miss picks location for missing element
# key1 and key2 are substrings to match
key1 = key[:miss]
key2 = key[miss+1:]
print 'breaking key',key,'into',key1,key2
# match1 and match2 are tuples of locations of start of matches
# for each substring in target
match1 = subStringMatchExact(target,key1)
match2 = subStringMatchExact(target,key2)
# when we get here, we have two tuples of start points
# need to filter pairs to decide which are correct
filtered = constrainedMatchPair(match1,match2,len(key1))
allAnswers = allAnswers + filtered
print 'match1',match1
print 'match2',match2
print 'possible matches for',key1,key2,'start at',filtered
print "------------------------------------"
return allAnswers
#Problem 4-----------------------------------------------------------------
def subStringMatchExactlyOneSub(target,key):
"""Returns indexes of key matches missing exactly one letter only"""
exactMatch = subStringMatchExact(target,key) #indexes of exact matches
subMatch = subStringMatchOneSub(key,target) #indexes of exact matches and one sub matches
answer = []
for each in subMatch:
if each not in exactMatch:
answer.append(each)
return tuple(answer)
No comments. Sign up or log in to comment # Problem Set 3
# Name: 4orty4
# Time: 5:00
from string import *
# target strings
target1 = 'atgacatgcacaagtatgcat'
target2 = 'atgaatgcatggatgtaaatgcag'
# key strings
key10 = 'a'
key11 = 'atg'
key12 = 'atgc'
key13 = 'atgca'
# Problem 1
def countSubStringMatch(target, key):
"""Iteratively counts matches in the string"""
i = 0 # tracks the postion of the slice
n = 0 # tracks the number of matching results found
while i < len(target):
j = find(target[i:], key) #tracks position of match relative to slice
if j == -1:
print 'Search Complete'
return n
else:
n += 1 #found match, add 1 to match counter
print 'Match ', n, 'found at position ', j+i #j+i = slice position + relative match position
i += j+1
print 'Error'
return None
def countSubStringMatchRecursive(target, key):
"""Recursively counts matches in the string"""
n = 1
i = find(target, key)
print i
if i == -1: #if no matches are found
return 0
else:
n += countSubStringMatchRecursive(target[i+1:], key)
return n
# Problems 2, 3 and 4
def subStringMatchExact(target,key):
"""Returns a tuple of the starting points of matches
in the target string"""
i = 0 # tracks the postion of the slice
sols = () # Creates an empty tuple to return after search
# Special case if the function is sent an empty string as key
# Returns a tuple with all numbers 0-length of target
if key == '': return tuple(range(len(target1)))
while i < (len(target)+1):
j = find(target[i:], key) #tracks position of match relative to slice
if j == -1:
# print 'Search Complete'
return sols
else:
sols +=(j+i,) #adds slice location to solution tuple
i += j+1
def constrainedMatchPair(firstMatch,secondMatch,length):
"""The function is given two tuples representing starting points
of two searches for a search string. The function should return
a tuple of all members (call it n) of the first tuple for which
there is an element in the second tuple (call it k) such that
n+m+1 = k, where m is the length of the first substring."""
ans = ()
for n in firstMatch:
matchTest = n + length + 1
for k in secondMatch: #searches for a matching k value in the second tuple
if k == matchTest: ans += (n,)
return ans
#Target and key were reversed from the template
#for consistency with other functions
def subStringMatchOneSub(target, key):
"""search for all locations of key in target, with one substitution"""
allAnswers = ()
for miss in range(0,len(key)):
# miss picks location for missing element
# key1 and key2 are substrings to match
key1 = key[:miss]
key2 = key[miss+1:]
print 'breaking key',key,'into',key1,key2
# match1 and match2 are tuples of locations of start of matches
# for each substring in target
match1 = subStringMatchExact(target,key1)
match2 = subStringMatchExact(target,key2)
# when we get here, we have two tuples of start points
# need to filter pairs to decide which are correct
filtered = constrainedMatchPair(match1,match2,len(key1))
allAnswers = allAnswers + filtered
print allAnswers
print 'match1',match1
print 'match2',match2
print 'possible matches for',key1,key2,'start at',filtered
return allAnswers
def removeDup(t):
"""Scans a tuple of integers and returns a new tuple
with duplicate integers removed"""
r = ()
for i in range(0, len(t)):
isMatch = False
for j in range(i+1, len(t)):
# print 't[i], t[j] = ', t[i], t[j]
if t[i] == t[j]:
isMatch = True
# print isMatch
if isMatch == False:
r+=(t[i],)
# print 'writing unique answer'
return r
def removeExactFromAll(exactMatches, allMatches):
"""Receives two tuples of integers. Creates and returns a tuple of
substitution matches that contains integers from allMatches not
included in exactMatches"""
subMatches = ()
for i in range (0, len(allMatches)):
isMatch = False
for j in range (0, len(exactMatches)):
if allMatches[i] == exactMatches[j]:
isMatch = True
if isMatch == False:
subMatches += (allMatches[i],)
return subMatches
def subStringMatchExactlyOneSub(target, key):
"""Returns a tuple representing the starting point
of matches with one substitution. It is produced by comparing
tuple containing the locations of exact matches with the
tuple containing location of substitution+exact matches,
and leaves only the substitution matches."""
#Get location of exact matches
exactMatches = subStringMatchExact(target,key)
#Get location of sub matches + exactMatches
allMatches = subStringMatchOneSub(target, key)
#Remove duplicate answers from allMatches
allMatches = removeDup(allMatches)
print ' Exact matches are at ', exactMatches
print ' Substitution matches are at ', allMatches
return tuple(sorted(removeExactFromAll(exactMatches, allMatches)))
x = key12
y = target2
answer = subStringMatchExactlyOneSub(target2, key13)
print 'Searched for ', x, 'in ', y
print 'Substitution matches are located at ', answer
No comments. Sign up or log in to comment didn't really understand what the last one was about and took me a long time to continue working on it so I put down a month (wich is probably true). #Problem1
from string import *
def countSubStringMatch(target,key):
count,x=0,0
while x !=-1:
if find(target,key,x)==-1:
return count
else:
x=find(target,key,x)+1
count+=1
def countSubStringMatchRecursive(target,key):
count=0
if find(target,key)==-1: return count
else: return countSubStringMatchRecursive(target[find(target,key)+1:],key)+1
#Problem2
def subStringMatchExact(target,key):
ourtuple=()
x=0
while x !=-1:
if find(target,key,x)==-1:
return ourtuple
else:
ourtuple=ourtuple[:]+(find(target,key,x),)
x=find(target,key,x)+1
#Problem3
def constrainedMatchPair(firstMatch,secondMatch,length):
matchedtuple=()
for targetsfirst in firstMatch:
for targetssecond in secondMatch:
if (targetsfirst-targetssecond+length==-1):
matchedtuple=matchedtuple[:]+(targetsfirst,)
return matchedtuple
#Problem4
def subStringMatchExactlyOneSub(target,key):
tupleForReturn=()
tupleOfAll=subStringMatchOneSub(key,target)
tupleOfExact=subStringMatchExact(target,key)
print tupleOfAll
print tupleOfExact
for i in tupleOfAll:
if i not in tupleOfExact: tupleForReturn+=(i,)
return tupleForReturn
No comments. Sign up or log in to comment Problem Set 3 - DNA Sequencing problem# Amy Karoline
# Course 600
# Problem Set 3, DNA Sequencing
# Time: ~6.5hours
# 01282011-02012011
######
from string import *
##Problem 1:
## Write two functions, called countSubStringMatch and
## countSubStringMatchRecursive that take two arguments, a key string and a
## target string. These functions iteratively and recursively count the number
## f instances of the key in the target string. You should complete definitions
## for
## def countSubStringMatch(target,key):
## and
## def countSubStringMatchRecursive (target, key):
##
## don't use count function
## target is big string
## key is small string
print ''
print 'Problem 1!'
print ''
def countSubStringMatch(target, key):
ctr = 0
found = find(target, key)
while found != -1:
found = find(target, key, found+1)
ctr += 1
return ctr
## You're looking for # of instances of key in target - key is small, target is big
def countSubStringRecursive(target,key):
foundAt = find(target, key)
bigLength = len(target)
smallLength = len(key)
if foundAt == -1:
return 0
nextIndex = foundAt + 1
return 1 + countSubStringRecursive(target[nextIndex:],key)
big = 'supercalifracalgilistic' #raw_input('key:')
small = 'cal' #raw_input('target:')
print countSubStringMatch(big,small)
print countSubStringRecursive(big,small) # should return 2
##Problem 2:
## Use recursive or iterative approaches.
## Write the function subStringMatchExact.This function takes two arguments:
## a target string, and a key string. It should return a tuple of the
## starting points of matches of the key string in the target string,
## when indexing starts at 0. Complete the definition for
## def subStringMatchExact(target,key):
##
## For example,
## subStringMatchExact("atgacatgcacaagtatgcat","atgc")
## would return the tuple (5, 15). The file ps3_template.py includes
## some test strings that you can use to test your function. In particular,
## we provide two target strings:
## target1 = 'atgacatgcacaagtatgcat'
## target2 = 'atgaatgcatggatgtaaatgcag'
## and four key strings:
## key10 = 'a'
## key11 = 'atg'
## key12 = 'atgc'
## key13 = 'atgca'
## Test your function on each combination of key and target string, as
## well as other examples that you create.
print ''
print 'Problem 2!'
print ''
def subStringMatchExact(big,small):
indSolns = ()
foundAt = find(big, small)
if foundAt == -1:
print 'There are no matches. Empty Set:'
return indSolns
else:
while foundAt != -1:
indSolns += (foundAt,)
new = foundAt + 1
foundAt = find(big, small, new)
return indSolns
a = 'atgacatgcacaagtatgcat'
b = 'atgc'
print subStringMatchExact(a,b)
target1 = 'atgacatgcacaagtatgcat'
target2 = 'atgaatgcatggatgtaaatgcag'
key10 = 'a'
key11 = 'atg'
key12 = 'atgc'
key13 = 'atgca'
print subStringMatchExact(target1, key10)
print subStringMatchExact(target1, key11)
print subStringMatchExact(target1, key12)
print subStringMatchExact(target1, key13)
print subStringMatchExact(target2, key10)
print subStringMatchExact(target2, key11)
print subStringMatchExact(target2, key12)
print subStringMatchExact(target2, key13)
##Problem 3:
## Near matches of key strings in target strings
## Write a function, which takes three arguments: a tuple representing starting points for
## the first substring, a tuple representing starting points for the second substring, and the length
## of the first substring. The function should return a tuple of all members (call it n) of the first
## tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is
## the length of the first substring.
print ''
print 'Problem 3!'
print ''
def constrainedMatchPair(firstMatch,secondMatch,length):
# firstmatch is a tuple of the starting points for first string matches
# secondmatch is a tuple of the starting points for second string matches
# length is length of the first string, m
# return a tuple of all elements n of the first tuple for which there is an element of the second tuple k
# such that n+m+1 = k and m is the length
# i.e. firstMatch[i] + length + 1 = secondmatch[i]
matchPairs = ()
for n in firstMatch:
k = n + length + 1
if k in secondMatch:
matchPairs += (n,)
return matchPairs
## given function for testing problem 3 from template file
def subStringMatchOneSub(target,key):
"""search for all locations of key in target, with one substitution"""
allAnswers = ()
for miss in range(0,len(key)):
# miss picks location for missing element
# key1 and key2 are substrings to match
key1 = key[:miss]
key2 = key[miss+1:]
print 'breaking key',key,'into',key1,key2
# match1 and match2 are tuples of locations of start of matches
# for each substring in target
match1 = subStringMatchExact(target,key1)
match2 = subStringMatchExact(target,key2)
# when we get here, we have two tuples of start points
# need to filter pairs to decide which are correct
filtered = constrainedMatchPair(match1,match2,len(key1))
allAnswers = allAnswers + filtered
print 'match1',match1
print 'match2',match2
print 'possible matches for',key1,key2,'start at',filtered
allAnswers=tuple(set(allAnswers))
return allAnswers
print subStringMatchOneSub(target1, key10)
print subStringMatchOneSub(target1, key11)
##Problem 4:
## Write a function, which takes two arguments: a target string and a key string.
## This function should return a tuple of all starting points of matches of the key to the
## target, such that exactly one element of the key is incorrectly matched to the target.
print ''
print 'Problem 4!'
print ''
def subStringMatchExactlyOneSub(target,key):
oneElemOffMatch = ()
allMatch = subStringMatchOneSub(target, key)
print 'allmatch is ', allMatch
exactMatch = subStringMatchExact(target, key)
print 'exactMatch is ', exactMatch
for p in range(0, len(allMatch)):
if allMatch[p] in exactMatch:
oneElemOffMatch += (allMatch[p],)
return oneElemOffMatch
print subStringMatchExactlyOneSub(target1, key10)
print subStringMatchExactlyOneSub(target1, key11)
No comments. Sign up or log in to comment Modified the test function for problem 3 to provide better debugging feedback from string import *
# Problem 1
#
# Write two functions, called countSubStringMatch and
# countSubStringMatchRecursive that take two arguments, a key string and
# a target string. These functions iteratively and recursively count the
# number of instances of the key in the target string. You should
# complete definitions for
#
# def countSubStringMatch(target,key):
#
# and
#
# def countSubStringMatchRecursive (target, key):
# Iterative function counts number of instances of "key" in "target"
def countSubStringMatch(target, key):
"""
Iterative function counts number of instances of "key" in "target"
"""
found = 0
current = find(target, key)
while current != -1:
found = found + 1
current = find(target, key, current +1)
return found
key = 'abc'
target = 'abcdabce'
print "Iterative implementation of 'countSubStringMatch' found '%s' %d times in '%s'" % (key, countSubStringMatch(target, key), target)
def countSubStringMatchRecursive(target, key):
"""
Recursive function counts number of instances of "key" in "target"
"""
index = find(target, key)
if index == -1:
return 0
nextIndex = index + 1
return 1 + countSubStringMatchRecursive(target[nextIndex:], key)
key = 'abc'
target = 'abcdabce'
print "Recursive implementation of 'countSubStringMatch' found '%s' %d times in '%s'" % (key, countSubStringMatchRecursive(target, key), target)
print
# Problem 2
#
# Write the function subStringMatchExact. This function takes two
# arguments: a target string, and a key string. It should return a tuple
# of the starting points of matches of the key string in the target
# string, when indexing starts at 0. Complete the definition for
#
# def subStringMatchExact(target,key):
#
# For example,
#
# subStringMatchExact("atgacatgcacaagtatgcat","atgc")
#
# would return the tuple (5, 15).
def subStringMatchExact(target, key):
"""
Returns a tuple containing all starting indexes for found matches of
key in target
"""
foundIndexes = ()
current = find(target, key)
while current != -1:
foundIndexes = foundIndexes + (current,)
current = find(target, key, current + 1)
return foundIndexes
# target strings
target1 = 'atgacatgcacaagtatgcat'
target2 = 'atgaatgcatggatgtaaatgcag'
# key strings
key10 = 'a'
key11 = 'atg'
key12 = 'atgc'
key13 = 'atgca'
print "target: '%s', key: '%s', indexes: " % (target1, key10), subStringMatchExact(target1, key10)
print "target: '%s', key: '%s', indexes: " % (target1, key11), subStringMatchExact(target1, key11)
print "target: '%s', key: '%s', indexes: " % (target1, key12), subStringMatchExact(target1, key12)
print "target: '%s', key: '%s', indexes: " % (target1, key13), subStringMatchExact(target1, key13)
print
print "target: '%s', key: '%s', indexes: " % (target2, key10), subStringMatchExact(target2, key10)
print "target: '%s', key: '%s', indexes: " % (target2, key11), subStringMatchExact(target2, key11)
print "target: '%s', key: '%s', indexes: " % (target2, key12), subStringMatchExact(target2, key12)
print "target: '%s', key: '%s', indexes: " % (target2, key13), subStringMatchExact(target2, key13)
print
# Problem 3
#
# Write a function, called constrainedMatchPair which takes three
# arguments: a tuple representing starting points for the first
# substring, a tuple representing starting points for the second
# substring, and the length of the first substring. The function should
# return a tuple of all members (call it n) of the first tuple for which
# there is an element in the second tuple (call it k) such that
# n+m+1 = k, where m is the length of the first substring.
def constrainedMatchPair(firstMatches, secondMatches, length):
"""
Returns a tuple of all starting indexes for the provided tuple of
first matches that have a corresponding index in secondMatches such
that the index in second match starts directly when the index from
the first match ends
"""
foundMatches = ()
for firstMatch in firstMatches:
for secondMatch in secondMatches:
if (firstMatch + length + 1) == secondMatch:
foundMatches = foundMatches + (firstMatch,)
return foundMatches
# Test function
def subStringMatchOneSub(key,target):
"""
search for all locations of key in target, with one substitution
"""
allAnswers = ()
print "key: '%s', target: '%s'" % (key, target)
for miss in range(0,len(key)):
# miss picks location for missing element
# key1 and key2 are substrings to match
key1 = key[:miss]
key2 = key[miss+1:]
print "breaking '%s' into '%s' and '%s'" % (key, key1, key2)
# match1 and match2 are tuples of locations of start of matches
# for each substring in target
match1 = subStringMatchExact(target,key1)
match2 = subStringMatchExact(target,key2)
# when we get here, we have two tuples of start points
# need to filter pairs to decide which are correct
filtered = constrainedMatchPair(match1,match2,len(key1))
allAnswers = allAnswers + filtered
print "matches for '%s': " % (key1,), match1
print "matches for '%s': " % (key2,), match2
print "possible matches for '%s*%s' start at: " % (key1, key2), filtered
return allAnswers
subStringMatchOneSub(key11, target1)
print
# Problem 4
#
# Write a function, called subStringMatchExactlyOneSub which takes two
# arguments: a target string and a key string. This function should
# return a tuple of all starting points of matches of the key to the
# target, such that at exactly one element of the key is incorrectly
# matched to the target. Complete the definition
def subStringMatchExactlyOneSub(target, key):
"""
Returns a tuple of all starting points for matches of key in target
such that one character in the match is incorrect
"""
print "Looking for instances of '%s' with exactly one substitution in '%s'" % (key, target)
exactMatches = subStringMatchExact(target, key)
partialAndExactMatches = ()
for gap in range(0, len(key)):
key1 = key[:gap]
key2 = key[gap+1:]
print "Splitting '%s' into '%s' and '%s'" % (key, key1, key2)
match1 = subStringMatchExact(target, key1)
print "Exact matches for '%s':" % (key1), match1
match2 = subStringMatchExact(target, key2)
print "Exact matches for '%s':" % (key2), match2
currentPartialAndExactMatches = constrainedMatchPair(match1, match2, len(key1))
print "Partial and exact matches for '%s*%s': " % (key1, key2), currentPartialAndExactMatches
partialAndExactMatches = partialAndExactMatches + currentPartialAndExactMatches
partialMatches = ()
for candidate in partialAndExactMatches:
if not candidate in exactMatches:
partialMatches = partialMatches + (candidate,)
return partialMatches
target = 'azcdabzdabcadcd'
key = 'abcd'
matchesExactlyOneSub = subStringMatchExactlyOneSub(target, key)
print "Matches in '%s' for '%s' with exactly 1 substitution: " % (target, key), matchesExactlyOneSub
No comments. Sign up or log in to comment # Problem Set 3 (Part 1)
# Name: Boogie
# Collaborators: None
# Time: 0:30
from string import *
def countSubStringMatchRecursion(target, key):
"""
purpose: to count the no. of occurrences of key in target string
parameters: target - target string, key - search string
output: count
"""
indexInTarget = 0
startIndex = 0
while indexInTarget != -1:
indexInTarget = find(target, key)
if indexInTarget != -1:
# reset startIndex of target to startIndex + length of the key
startIndex = indexInTarget + len(key)
# start new search, with modified target
return countSubStringMatchRecursion(target[startIndex:],key) + 1
return 0
def countSubStringMatch(target, key):
ctr = 0
indexInTarget = 0
startIndex = 0
while indexInTarget != -1:
indexInTarget = find(target, key)
if indexInTarget != -1:
ctr = ctr + 1
startIndex = indexInTarget + len(key)
target = target[startIndex:]
return ctr
# Problem Set 3 (Part 2)
# Name: Boogie
# Collaborators: None
# Time: 0:30
from string import *
def subStringMatchExact(target, key):
indexInTarget = 0
startIndex = 0
ans = ()
while indexInTarget != -1:
indexInTarget = find(target, key)
if indexInTarget != -1:
ans = ans + (startIndex + indexInTarget,)
startIndex = indexInTarget + len(key)
target = target[startIndex:]
return ans
No comments. Sign up or log in to comment from string import *
##Problem #1
#We will define a function that returns all instances and appearances of a key string within a target string
#The """string""" provides the user with a short description of the function
def countSubStringMatch(target, key):
"""Returns the locations where the key (string) exists and number of occurances in the target (string)"""
search = True #Setting the state variables
locations = ()
place = 0
while search == True:
result = find(target, key, place) #The find function returns where in the string the key appears
if result != -1 and result != 0: #testing to see if it appears anywhere
locations += (result,) #If id does, add it to the tuple and shift the search
place = result + 1 #starting point
elif result == -1 and locations == (): #NOTE: find returns 0 if you search for an empty string ('') in any target
print key, 'does not exist in', target #or result == 0: can be added to remove the case whe
search = False
elif result == -1 and locations != ():
print 'There are', len(locations), 'places where', key, 'exists.'
print 'They are', locations
search = False
# The recursive function below will only count the number of occurances
def countSubStringMatchRecursive(target, key):
"""Returns the locations where the key (string) exists in the target (string)"""
result = find(target, key) #state variable every time the function is called.
if result != -1: #test for base case:
target = target[result + 1:] #if not then shorten the target string and do it again
return 1 + countSubStringMatchRecursive(target, key) #return 1 + the result of the next iteration
else: #the recursive 'nesting' in the return allows you to 'count' without a counting variable
return 0 #use return 0 vs. None because you can't mix 1
#(the integer result from the above return) with the 'type' None
##Problem #2
#This will modify the first function to return only the tuple with mactched locations
def subStringMatchExact(target, key):
"""Returns the locations where the key (string) exists"""
search = True #Setting the state variables
locations = ()
place = 0
while search == True:
result = find(target, key, place) #The find function returns where in the string the key appears
if result != -1: #testing to see if it appears anywhere. Can add "and result != 0" to remove '' search
locations += (result,) #If id does, add it to the tuple and shift the search
place = result + 1 #starting point
else:
search = False #if result == -1, end the loop and return locations
return locations
##Problem #3
#This will define a function that returns all places where
def constrainedMatchPair(firstMatch, secondMatch, length):
"""returns tuple satisfying the conditions firstMatch + length + 1 = secondMatch"""
replica = () #initializes the tuple variable 'replica'
for i in firstMatch: #sets the value in firstMatch
for j in secondMatch: #scans the values in secondMatch such that
if 1 + length + i == j: #they satisfy this contition
replica += (i,) #if they do, add it to replica. Otherwise continue the loop
return replica #returns the values that satisfy the if statement.
No comments. Sign up or log in to comment # Problem Set 3a
# Name: Matt Coley
#
from string import *
def countSubStringMatch(target, key):
"""search for the number of matches of key in target"""
matchCnt = 0
lastMatchLoc = 0
matchChk = 1
while matchChk:
currMatchLoc = find(target, key, lastMatchLoc)
if currMatchLoc == -1:
matchChk = 0
else:
matchCnt += 1
lastMatchLoc = currMatchLoc + 1
return matchCnt
def countSubStringMatchRecursive(target, key):
"""search for the number of matches of key in target"""
currMatchLoc = find(target, key)
if currMatchLoc == -1:
return 0
else:
return 1 + countSubStringMatchRecursive(target[currMatchLoc+1:], key)
# Problem Set 3b
# Name: Matt Coley
#
from string import *
def subStringMatchExact(target, key):
"""search for all locations of key in target"""
matchLst = []
lastMatchLoc = 0
matchChk = 1
while matchChk:
currMatchLoc = find(target, key, lastMatchLoc)
if currMatchLoc == -1:
matchChk = 0
else:
matchLst.append(currMatchLoc)
lastMatchLoc = currMatchLoc + 1
return tuple(matchLst)
# Problem Set 3c
# Name: Matt Coley
#
from string import *
def subStringMatchExact(target, key):
"""search for all locations of key in target"""
matchLst = []
lastMatchLoc = 0
matchChk = 1
while matchChk:
currMatchLoc = find(target, key, lastMatchLoc)
if currMatchLoc == -1:
matchChk = 0
else:
matchLst.append(currMatchLoc)
lastMatchLoc = currMatchLoc + 1
return tuple(matchLst)
def constrainedMatchPair(firstMatch, secondMatch, length):
"""search for all locations of firstMatch, where secondMatch follows with 1 gap in between"""
matchLst = []
for n in firstMatch:
for k in secondMatch:
if n+length+1 == k:
matchLst.append(n)
return tuple(matchLst)
# Problem Set 3d
# Name: Matt Coley
#
from string import *
def subStringMatchExact(target, key):
"""search for all locations of key in target"""
matchLst = []
lastMatchLoc = 0
matchChk = 1
while matchChk:
currMatchLoc = find(target, key, lastMatchLoc)
if currMatchLoc == -1:
matchChk = 0
else:
matchLst.append(currMatchLoc)
lastMatchLoc = currMatchLoc + 1
return tuple(matchLst)
def constrainedMatchPair(firstMatch, secondMatch, length):
"""search for all locations of firstMatch, where secondMatch follows with 1 gap in between"""
matchLst = []
for n in firstMatch:
for k in secondMatch:
if n+length+1 == k:
matchLst.append(n)
return tuple(matchLst)
def subStringMatchExactlyOneSub(target, key):
"""search for all locations of key in target, only containing one substitution"""
allAnswers = ()
onlySubAns = []
for miss in range(0,len(key)):
# miss picks location for missing element
# key1 and key2 are substrings to match
key1 = key[:miss]
key2 = key[miss+1:]
## print 'breaking key',key,'into',key1,key2
# match1 and match2 are tuples of locations of start of matches
# for each substring in target
match1 = subStringMatchExact(target,key1)
match2 = subStringMatchExact(target,key2)
# when we get here, we have two tuples of start points
# need to filter pairs to decide which are correct
filtered = constrainedMatchPair(match1,match2,len(key1))
allAnswers = allAnswers + filtered
## print 'match1',match1
## print 'match2',match2
## print 'possible matches for',key1,key2,'start at',filtered
onlySubAns = list(allAnswers)
numRem = 0
for x in allAnswers:
for y in subStringMatchExact(target, key):
if x == y:
onlySubAns.remove(x)
numRem += 1
return tuple(onlySubAns)
No comments. Sign up or log in to comment #Problem Set 3
#Name: chip
#Time: 0:40
target1 = 'atgacatgcacaagtatgcat'
target2 = 'atgaatgcatggatgtaaatgcag'
key10 = 'a'
key11 = 'atg'
key12 = 'atgc'
key13 = 'atgca'
#Problem 1
def countSubStringMatch(target, key):
result = target.find(key)
count = 0
while result != -1:
count += 1
result = target.find(key, result + 1)
return count
def countSubStringMatchRecursive(target, key):
result = target.find(key)
if result == -1:
return 0;
else:
return 1 + countSubStringMatchRecursive(target[result+len(key):], key)
#Problem 2
def subStringMatchExact(target,key):
result = target.find(key)
index = ()
while result != -1:
index += (result,)
result = target.find(key, result + 1)
return index
#Problem 3
def constrainedMatchPair(firstMatch, secondMatch, length):
matches = ()
for n in firstMatch:
k = n + length + 1
if k in secondMatch:
matches += (n,)
return matches
def subStringMatchOneSub(key,target):
"""search for all locations of key in target, with one substitution"""
allAnswers = ()
for miss in range(0,len(key)):
# miss picks location for missing element
# key1 and key2 are substrings to match
key1 = key[:miss]
key2 = key[miss+1:]
print('breaking key',key,'into',key1,key2)
# match1 and match2 are tuples of locations of start of matches
# for each substring in target
match1 = subStringMatchExact(target,key1)
match2 = subStringMatchExact(target,key2)
# when we get here, we have two tuples of start points
# need to filter pairs to decide which are correct
filtered = constrainedMatchPair(match1,match2,len(key1))
allAnswers = allAnswers + filtered
print('match1',match1)
print('match2',match2)
print('possible matches for',key1,key2,'start at',filtered)
return allAnswers
#Problem 4
def subStringMatchExactlyOneSub(target, key):
return tuple(set(subStringMatchOneSub(key, target)) - set(subStringMatchExact(target, key)))
No comments. Sign up or log in to comment Matching strings: a biological perspective # Problem Set 3 (Part I)
# Name: Joe Li
# Time: 2:00
#
from string import *
def countSubStringMatch(target,key):
count=0
index=0
while find(target,key,index)!=-1: # while searching the target from index and find a key
index=find(target,key,index)+1 # search from the next character
count+=1
return count
def countSubStringMatchRecursive (target, key):
target=target[find(target,key)+1:] # slice 'target'
if find(target,key)==-1: # if the substring doesn't contain the key
return 1 # the base case return 1 in order to count the last removed one
else:
recurse=countSubStringMatchRecursive(target,key) # recerse
return recurse+1 # count
# Problem Set 3 (Part II)
# Name: Joe Li
# Time 1:00
#
from string import *
def subStringMatchExact(target,key):
index=0
match=()
while find(target,key,index)!=-1:
index=find(target,key,index) # bind the position of found key to index
match+=(index,) # add to tuple
index+=1 # search from next character
return match
target1 = 'atgacatgcacaagtatgcat'
target2 = 'atgaatgcatggatgtaaatgcag'
key10 = 'a'
key11 = 'atg'
key12 = 'atgc'
key13 = 'atgca'
print subStringMatchExact(target1,key10)
print subStringMatchExact(target1,key11)
print subStringMatchExact(target1,key12)
print subStringMatchExact(target1,key13)
print subStringMatchExact(target2,key10)
print subStringMatchExact(target2,key11)
print subStringMatchExact(target2,key12)
print subStringMatchExact(target2,key13)
# Problem Set 3 (Part III)
# Name: Joe Li
# Time 0:30
#
from string import *
def subStringMatchExact(target,key):
index=0
match=()
while find(target,key,index)!=-1:
index=find(target,key,index) # bind the position of found key to index
match+=(index,) # add to tuple
index+=1 # search from next character
return match
def constrainedMatchPair(firstMatch,secondMatch,length):
filtered=()
for n in range(0,len(firstMatch)): # for every element in 1st & 2nd Match
for k in range(0,len(secondMatch)):
if firstMatch[n]+length+1==secondMatch[k]: # if n+m+1=k holds
filtered+=(firstMatch[n],) # add such n to result
return filtered
def subStringMatchOneSub(key,target):
"""search for all locations of key in target, with one substitution"""
allAnswers = ()
for miss in range(0,len(key)):
# miss picks location for missing element
# key1 and key2 are substrings to match
key1 = key[:miss]
key2 = key[miss+1:]
print 'breaking key',key,'into',key1,key2
# match1 and match2 are tuples of locations of start of matches
# for each substring in target
match1 = subStringMatchExact(target,key1)
match2 = subStringMatchExact(target,key2)
# when we get here, we have two tuples of start points
# need to filter pairs to decide which are correct
filtered = constrainedMatchPair(match1,match2,len(key1))
allAnswers = allAnswers + filtered
print 'match1',match1
print 'match2',match2
print 'possible matches for',key1,key2,'start at',filtered
return allAnswers
# Problem Set 3 (Part IV)
# Name: Joe Li
# Time 0:30
#
from string import *
def subStringMatchExact(target,key):
index=0
match=()
while find(target,key,index)!=-1:
index=find(target,key,index) # bind the position of found key to index
match+=(index,) # add to tuple
index+=1 # search from next character
return match
def constrainedMatchPair(firstMatch,secondMatch,length):
filtered=()
for n in range(0,len(firstMatch)): # for every element in 1st & 2nd Match
for k in range(0,len(secondMatch)):
if firstMatch[n]+length+1==secondMatch[k]: # if n+m+1=k holds
filtered+=(firstMatch[n],) # add such n to result
return filtered
def subStringMatchOneSub(key,target):
"""search for all locations of key in target, with one substitution"""
allAnswers = ()
for miss in range(0,len(key)):
# miss picks location for missing element
# key1 and key2 are substrings to match
key1 = key[:miss]
key2 = key[miss+1:]
print 'breaking key',key,'into',key1,key2
# match1 and match2 are tuples of locations of start of matches
# for each substring in target
match1 = subStringMatchExact(target,key1)
match2 = subStringMatchExact(target,key2)
# when we get here, we have two tuples of start points
# need to filter pairs to decide which are correct
filtered = constrainedMatchPair(match1,match2,len(key1))
allAnswers = allAnswers + filtered
print 'match1',match1
print 'match2',match2
print 'possible matches for',key1,key2,'start at',filtered
allAnswers=tuple(set(allAnswers))
return allAnswers
def subStringMatchExactlyOneSub(target,key):
exact=list(subStringMatchExact(target,key))
one=list(subStringMatchOneSub(key,target))
for index in range(0,len(exact)):
one.remove(exact[index]) #remove those elements occur in the 1st tuple from the 2nd tuple
return tuple(one)
No comments. Sign up or log in to comment As I remember, I took a really straightforward way of solving these problems =/ Test functions do all the calls. ###############
## Problem 1 ##
###############
from string import *
def count_sub_string_match(target, key):
"""Find all occurrences of a string in another"""
counter = 0
position = 0
pointer = 0
while(pointer < len(target)):
position = find(target, key, pointer)
if position != -1:
counter += 1
pointer = position + 1
else:
pointer += 1
return counter
def count_sub_string_match_recursive(target, key):
"""Find all occurrences of a string in another with recursion"""
counter = 0
position = 0
position = find(target, key)
if position == -1:
return 0
else:
position += 1
return 1 + count_sub_string_match_recursive(target[position:], key)
def test_count_sub_string():
"""testing our functions"""
target1 = 'atgacatgcacaagtatgcat'
target2 = 'atgaatgcatggatgtaaatgcag'
key10 = 'a'
key11 = 'atg'
key12 = 'atgc'
key13 = 'atgca'
# Testing iterative version
print "Iterative function"
print count_sub_string_match(target1, key10)
print count_sub_string_match(target1, key11)
print count_sub_string_match(target1, key12)
print count_sub_string_match(target1, key13)
print count_sub_string_match(target2, key10)
print count_sub_string_match(target2, key11)
print count_sub_string_match(target2, key12)
print count_sub_string_match(target2, key13)
# Testing recursive version
print "Recursive function"
print count_sub_string_match_recursive(target1, key10)
print count_sub_string_match_recursive(target1, key11)
print count_sub_string_match_recursive(target1, key12)
print count_sub_string_match_recursive(target1, key13)
print count_sub_string_match_recursive(target2, key10)
print count_sub_string_match_recursive(target2, key11)
print count_sub_string_match_recursive(target2, key12)
print count_sub_string_match_recursive(target2, key13)
test_count_sub_string()
###############
## Problem 2 ##
###############
from string import *
def count_sub_string_match_exact(target, key):
"""Find all occurrences of a string in another"""
position_list = []
position = 0
pointer = 0
while(pointer < len(target)):
position = find(target, key, pointer)
if position != -1:
position_list.append(position)
pointer = position + 1
else:
pointer += 1
return tuple(position_list)
def test_count_sub_string():
"""testing our functions"""
target1 = 'atgacatgcacaagtatgcat'
target2 = 'atgaatgcatggatgtaaatgcag'
key10 = 'a'
key11 = 'atg'
key12 = 'atgc'
key13 = 'atgca'
# Testing iterative version
print "Iterative function"
print count_sub_string_match_exact(target1, key10)
print count_sub_string_match_exact(target1, key11)
print count_sub_string_match_exact(target1, key12)
print count_sub_string_match_exact(target1, key13)
print count_sub_string_match_exact(target2, key10)
print count_sub_string_match_exact(target2, key11)
print count_sub_string_match_exact(target2, key12)
print count_sub_string_match_exact(target2, key13)
test_count_sub_string()
###############
## Problem 3 ##
###############
from string import *
def sub_string_match_exact(target, key):
"""Find all occurrences of a string in another"""
position_list = []
position = 0
pointer = 0
while(pointer < len(target)):
position = find(target, key, pointer)
if position != -1:
position_list.append(position)
pointer = position + 1
else:
pointer += 1
return tuple(position_list)
def constrained_match_pair(first_match, second_match, length):
""" Find intersection """
intersection = []
for n in first_match:
for m in second_match:
if n + length + 1 == m:
intersection.append(n)
return tuple(intersection)
def sub_string_match_one_sub(target, key):
"""search for all locations of key in target, with one substitution"""
allAnswers = ()
for miss in range(0, len(key)):
# miss picks location for missing element
# key1 and key2 are substrings to match
key1 = key[:miss]
key2 = key[miss+1:]
print 'breaking key', key, 'into', key1, key2
# match1 and match2 are tuples of locations of start of matches
# for each substring in target
match1 = sub_string_match_exact(target, key1)
match2 = sub_string_match_exact(target, key2)
# when we get here, we have two tuples of start points
# need to filter pairs to decide which are correct
filtered = constrained_match_pair(match1, match2, len(key1))
allAnswers = allAnswers + filtered
print 'match1', match1
print 'match2', match2
print 'possible matches for', key1, key2, 'start at', filtered
print ''
return allAnswers
def test_count_sub_string():
"""testing our functions"""
target1 = 'atgacatgcacaagtatgcat'
target2 = 'atgaatgcatggatgtaaatgcag'
#key10 = 'a'
key11 = 'atg'
key12 = 'atgc'
key13 = 'atgca'
# Testing problem 3
# print sub_string_match_one_sub(target1, key10)
print sub_string_match_one_sub(target1, key11)
print sub_string_match_one_sub(target1, key12)
print sub_string_match_one_sub(target1, key13)
# print sub_string_match_one_sub(target2, key10)
print sub_string_match_one_sub(target2, key11)
print sub_string_match_one_sub(target2, key12)
print sub_string_match_one_sub(target2, key13)
test_count_sub_string()
###############
## Problem 4 ##
###############
from string import *
def sub_string_match_exact(target, key):
"""Find all occurrences of a string in another"""
position_list = ()
position = 0
pointer = 0
while(pointer < len(target)):
position = find(target, key, pointer)
if position != -1:
position_list += (position,)
pointer = position + 1
else:
pointer += 1
return position_list
def constrained_match_pair(first_match, second_match, length):
""" Find intersection """
intersection = ()
for n in first_match:
for m in second_match:
if n + length + 1 == m:
intersection += (n,)
return intersection
def sub_string_match_one_exactly_one_sub(target, key):
"""search for all locations of key in target, with one substitution"""
allAnswers = ()
for miss in range(0, len(key)):
print allAnswers
# miss picks location for missing element
# key1 and key2 are substrings to match
key1 = key[:miss]
key2 = key[miss+1:]
print 'breaking key', key, 'into', key1, key2
# match1 and match2 are tuples of locations of start of matches
# for each substring in target
match1 = sub_string_match_exact(target, key1)
match2 = sub_string_match_exact(target, key2)
# when we get here, we have two tuples of start points
# need to filter pairs to decide which are correct
filtered = constrained_match_pair(match1, match2, len(key1))
for one_sub in filtered:
if one_sub not in match2:
allAnswers = allAnswers + (one_sub,)
print 'match1', match1
print 'match2', match2
print 'possible matches for', key1, key2, 'start at', filtered
print ''
return allAnswers
def test_count_sub_string():
"""testing our functions"""
target1 = 'atgacatgcacaagtatgcat'
target2 = 'atgaatgcatggatgtaaatgcag'
key10 = 'a'
key11 = 'atg'
key12 = 'atgc'
key13 = 'atgca'
# Testing problem 3
# print sub_string_match_one_exactly_one_sub(target1, key10)
# print sub_string_match_one_exactly_one_sub(target1, key11)
# print sub_string_match_one_exactly_one_sub(target1, key12)
# print sub_string_match_one_exactly_one_sub(target1, key13)
# print sub_string_match_one_exactly_one_sub(target2, key10)
# print sub_string_match_one_exactly_one_sub(target2, key11)
# print sub_string_match_one_exactly_one_sub(target2, key12)
print sub_string_match_one_exactly_one_sub(target2, key13)
test_count_sub_string()
No comments. Sign up or log in to comment Did they do this to make sure we were paying attention? close = subStringMatchOneSub(key, target) # Problem Set 3
from string import *
# target strings
target1 = 'atgacatgcacaagtatgcat'
target2 = 'atgaatgcatggatgtaaatgcag'
target3 = 'accaccaccaccaccaccaccacca'
# key strings
key10 = 'a'
key11 = 'atg'
key12 = 'atgc'
key13 = 'atgca'
key14 = 'acca'
###################
# Problem 3a #
###################
def countSubStringMatch(target, key):
""" Iteratively counts the number of times a term appears in a string"""
count = next = 0
while find(target, key, next) != -1:
next = find(target, key, next) + 1
count += 1
return count
def countSubStringMatchRecursive (target, key):
""" Recursively counts the number of times a term appears in a string"""
index = find(target, key)
if index == -1:
return 0
else:
# Slice notation says "Everything except the first part that we already searched"
# Eg, start next recursion one place after the previous match that we have found.
return 1 + countSubStringMatchRecursive(target[index+1:], key)
###################
# Problem 3b #
###################
def subStringMatchExact(target,key):
matchList = []
startFrom = 0
index = find(target, key, startFrom)
while index != -1:
matchList.append(index)
startFrom = index + 1
index = find(target, key, startFrom)
return tuple(matchList)
###################
# Problem 3c #
###################
def constrainedMatchPair(firstMatch,secondMatch,length):
# firstMatch and secondMatch are tuples
# n is the starting point of the first substring match
# m is the length of the first substring
# k is the sum of n + m + 1
matches = []
for n in firstMatch:
for k in secondMatch:
m = length
if n + m + 1 == k:
matches.append(n)
return tuple(matches)
def subStringMatchOneSub(key, target):
"""search for all locations of key in target, with one substitution"""
# Uncomment the print statements to get more output.
allAnswers = ()
for miss in range(0,len(key)):
# miss picks location for missing element
# key1 and key2 are substrings to match
key1 = key[:miss]
key2 = key[miss+1:]
# print 'breaking key',key,'into',key1,key2
# match1 and match2 are tuples of locations of start of matches
# for each substring in target
match1 = subStringMatchExact(target,key1)
match2 = subStringMatchExact(target,key2)
# when we get here, we have two tuples of start points
# need to filter pairs to decide which are correct
filtered = constrainedMatchPair(match1,match2,len(key1))
allAnswers = allAnswers + filtered
# print 'match1',match1
# print 'match2',match2
# print 'possible matches for',key1,key2,'start at',filtered
return allAnswers
###################
# Problem 3d #
###################
def subStringMatchExactlyOneSub(key, target):
"""Returns tuple of ONLY partial matches"""
onesub = () # One heart, lets get together and feel all right
exact = subStringMatchExact(target, key)
close = subStringMatchOneSub(key, target)
for i in close:
if i not in exact:
onesub += (i,)
return onesub
###################
# Code test output #
###################
print "Testing code..."
print "The target strand of DNA is",(target2),"and the search key is",(key13)
print "Exact matches for",(key13),"were found at these positions:",subStringMatchExact(target2, key13)
print "Possible one-substitution matches were found at:",subStringMatchOneSub(key13, target2)
print "DNA sequences with only one different base pair found at:",subStringMatchExactlyOneSub(key13, target2)
No comments. Sign up or log in to comment
# Set 3
# jyen
from string import *
def countSubStringMatch (target, key):
""" Iteratively counts the number of times a term appears in a string"""
count = 0
place = 0
while find(target, key, place) != -1:
place = find(target, key, place) + 1
count += 1
return count
def countSubStringMatchRecursive (target, key):
""" Recursively counts the number of times a term appears in a string"""
if find(target, key) != -1:
return 1 + countSubStringMatchRecursive(target[find(target, key)+1:], key)
return 0
def subStringMatchExact (target, key):
"""Iteratively finds the locations where a term appears in a string"""
places = []
index = 0
while find(target, key, index) != -1:
places.append(find(target, key, index))
index = find(target, key, index) + 1
return tuple(places)
def constrainedMatchPair (firstMatch, secondMatch, length):
places = ()
for x in firstMatch:
for y in secondMatch:
if x + length + 1 == y:
places += (x,)
return places
def subStringMatchOneSub(target,key):
"""search for all locations of key in target, with one substitution"""
allAnswers = ()
for miss in range(0,len(key)):
# miss picks location for missing element
# key1 and key2 are substrings to match
key1 = key[:miss]
key2 = key[miss+1:]
#print 'breaking key',key,'into',key1,key2
# match1 and match2 are tuples of locations of start of matches
# for each substring in target
match1 = subStringMatchExact(target,key1)
match2 = subStringMatchExact(target,key2)
# when we get here, we have two tuples of start points
# need to filter pairs to decide which are correct
filtered = constrainedMatchPair(match1,match2,len(key1))
allAnswers = allAnswers + filtered
#print 'match1',match1
#print 'match2',match2
#print 'possible matches for',key1,key2,'start at',filtered
return allAnswers
def subStringMatchExactlyOneSub (target, key):
nearmatches = ()
exactmatches = subStringMatchExact(target, key)
allmatches = subStringMatchOneSub(target, key)
for x in allmatches:
if x not in exactmatches:
nearmatches += (x,)
return nearmatches
target1 = 'atgacatgcacaagtatgcat'
target2 = 'atgaatgcatggatgtaaatgcag'
key10 = 'a'
key11 = 'atg'
key12 = 'atgc'
key13 = 'atgca'
print countSubStringMatch(target1,key12)
print countSubStringMatchRecursive(target1,key12)
print subStringMatchExact(target2,key12)
print subStringMatchOneSub(target2, key12)
print subStringMatchExactlyOneSub(target2, key12)
No comments. Sign up or log in to comment from string import *
# this is a code file that you can use as a template for submitting your
# solutions
# these are some example strings for use in testing your code
# target strings
target1 = 'atgacatgcacaagtatgcat'
target2 = 'atgaatgcatggatgtaaatgcag'
# key strings
key10 = 'a'
key11 = 'atg'
key12 = 'atgc'
key13 = 'atgca'
#problem 1
def countSubStringMatch(target,key):
"""Given a target string and a given substring
returns the number of occurances of the substring"""
countOfMatches = 0
currentPosition = 0
while currentPosition <= len(target):
if find(target, key, currentPosition) == -1:
if countOfMatches > 0:
return countOfMatches
else:
return 0
else:
countOfMatches += 1
currentPosition = find(target, key, currentPosition) + 1
return countOfMatches
def countSubStringMatchRecursive(target, key):
"""Given a target string and a given substring
returns the number of occurances of the substring
(recursive)"""
currentPosition = find(target, key)
if find(target, key) == -1:
return 0
else:
return 1 + countSubStringMatchRecursive(target[currentPosition+1:], key)
#problem 2
def subStringMatchExact(target,key):
"""Given a target string and a given substring
returns the number of occurances of the substring"""
locationOfMatches = []
countOfMatches = 0
currentPosition = 0
while currentPosition <= len(target):
if find(target, key, currentPosition) == -1:
if countOfMatches > 0:
result = tuple(locationOfMatches)
return result
else:
return ()
else:
countOfMatches += 1
currentPosition = find(target, key, currentPosition)
locationOfMatches.append(currentPosition)
currentPosition += 1
result = tuple(locationOfMatches)
return result
#problem 3
def subStringMatchOneSub(key,target):
"""search for all locations of key in target, with one substitution"""
allAnswers = ()
for miss in range(0,len(key)):
# miss picks location for missing element
# key1 and key2 are substrings to match
key1 = key[:miss]
key2 = key[miss+1:]
#print 'breaking key',key,'into',key1,key2
# match1 and match2 are tuples of locations of start of matches
# for each substring in target
match1 = subStringMatchExact(target,key1)
match2 = subStringMatchExact(target,key2)
# when we get here, we have two tuples of start points
# need to filter pairs to decide which are correct
filtered = constrainedMatchPair(match1,match2,len(key1))
allAnswers = allAnswers + filtered
#print 'match1',match1
#print 'match2',match2
#print 'possible matches for',key1,key2,'start at',filtered
return allAnswers
def constrainedMatchPair(first, second, length):
locationOfMatches = []
for position in first:
for location in second:
if position + length + 1 == location:
locationOfMatches.append(position)
#print "location of matches = "
#print locationOfMatches
#else:
#print "position = %i, length = %i, location = %i" % (position, length, location)
result = tuple(locationOfMatches)
return result
#problem 4
def subStringMatchExactlyOneSub(key,target):
result = list(subStringMatchOneSub(key, target))
matchesWithOneSubOrLess = subStringMatchOneSub(key, target)
matchesExact = subStringMatchExact(target, key)
for match in matchesWithOneSubOrLess:
if match in matchesExact:
result.remove(match)
readiedResult = tuple(result)
return readiedResult
No comments. Sign up or log in to comment from string import *
def countSubStringMatch(target, key):
"""counts the instances of key in target iteratively (exact matches only)"""
count = 0
while find(target,key) != -1:
count += 1
target = target[find(target,key)+1:]
return count
def countSubStringMatchRecursive(target,key):
"""counts the instances of key in target recursively (exact matches only)"""
idx = find(target,key)
if idx == -1: return 0
else: return 1 + countSubStringMatchRecursive(target[idx+1:],key)
def subStringMatchExact(target, key):
"""searches for instances of key in target (exact matches only)"""
out = ()
idx = -1
# The target is searched from one past the previously found index
# (initialized at -1 so as to start searching at 0) to find
# each instance of the key in the target.
while find(target,key,idx+1) != -1:
idx = find(target,key,idx+1)
out += (idx,)
return out
def constrainedMatchPair(firstMatch, secondMatch, length):
"""for each element in firstMatch, searches for an element in secondMatch
that represents an instance of the key with one substution"""
out = ()
for i in firstMatch:
for j in secondMatch:
if i + length + 1 == j:
out += (i,)
return out
#####Provided with assignment##############################################
def subStringMatchOneSub(key,target):
"""search for all locations of key in target, with one substitution"""
allAnswers = ()
for miss in range(0,len(key)):
# miss picks location for missing element
# key1 and key2 are substrings to match
key1 = key[:miss]
key2 = key[miss+1:]
# match1 and match2 are tuples of locations of start of matches
# for each substring in target
match1 = subStringMatchExact(target,key1)
match2 = subStringMatchExact(target,key2)
# when we get here, we have two tuples of start points
# need to filter pairs to decide which are correct
filtered = constrainedMatchPair(match1,match2,len(key1))
allAnswers = allAnswers + filtered
return allAnswers
###########################################################################
def subStringMatchExactlyOneSub(target,key):
"""searches for instances of key in target with exactly one substitution"""
exact = str(subStringMatchExact(target,key))
both = subStringMatchOneSub(key, target) # has exact matches & single subs
out = ()
# The element is added to the output if it (1) is not in the
# list of exact matches and (2) has not already been added
# to the output.
for i in both:
if countSubStringMatch(exact,str(i)) == 0 and\
countSubStringMatch(str(out),str(i)) == 0:
out += (i,)
return out
No comments. Sign up or log in to comment #Problem Set 3a
#jayd
from string import *
def countSubStringMatch(target,key):
count=0
while target:
location=find(target,key)
if location == -1:
break
count += 1
target=target[location + 1:]
return count
print countSubStringMatch("ABXXABXXAB","AB")
#Result = 3
def countSubStringMatchRecursive(target,key):
location = find(target,key)
if location == -1:
return 0
else:
return 1 + countSubStringMatchRecursive(target[location+len(key):],key)
print countSubStringMatchRecursive("ABXXABXXAB","AB")
#Result = 3
--------------------------------------------------------------
Problem set 3b
#jayd
from string import *
def subStringMatchExact(target,key):
matchLocation = []
start = 0
while True:
location = find(target,key,start)
#break loop if no more matches found
if location == -1:
break
matchLocation.append(location)
start = location + 1
return tuple(matchLocation)
#TESTS
targets = ('atgacatgcacaagtatgcat','atgaatgcatggatgtaaatgcag')
keys = ('a','atg','atgc','atgca')
for target in targets:
for key in keys:
print "Target: " + target
print "Key: " + key
print "Solution: " + str(subStringMatchExact(target,key))
#Output:
# Target: atgacatgcacaagtatgcat
# Key: a
# Solution: (0, 3, 5, 9, 11, 12, 15, 19)
# Target: atgacatgcacaagtatgcat
# Key: atg
# Solution: (0, 5, 15)
# Target: atgacatgcacaagtatgcat
# Key: atgc
# Solution: (5, 15)
# Target: atgacatgcacaagtatgcat
# Key: atgca
# Solution: (5, 15)
# Target: atgaatgcatggatgtaaatgcag
# Key: a
# Solution: (0, 3, 4, 8, 12, 16, 17, 18, 22)
# Target: atgaatgcatggatgtaaatgcag
# Key: atg
# Solution: (0, 4, 8, 12, 18)
# Target: atgaatgcatggatgtaaatgcag
# Key: atgc
# Solution: (4, 18)
# Target: atgaatgcatggatgtaaatgcag
# Key: atgca
# Solution: (4, 18)
------------------------------------------------------------
#Problem set 3d
#jayd
from string import *
# target strings
target1 = 'atgacatgcacaagtatgcat'
target2 = 'atgaatgcatggatgtaaatgcag'
# key strings
key10 = 'a'
key11 = 'atg'
key12 = 'atgc'
key13 = 'atgca'
def subStringMatchExact(target,key):
"""Returns a tuple of the exact matches"""
matchLocation = []
start = 0
while True:
location = find(target,key,start)
#break loop if no more matches found
if location == -1:
break
matchLocation.append(location)
start = location + 1
return tuple(matchLocation)
def constrainedMatchPair(firstMatch,secondMatch,length):
matches=[]
for match in firstMatch:
for match2 in secondMatch:
if match + length + 1 == match2:
matches.append(match)
return tuple(matches)
def subStringMatchOneSub(target,key):
"""search for all locations of key in target, with one substitution"""
allAnswers = ()
for miss in range(0,len(key)):
key1 = key[:miss]
key2 = key[miss+1:]
print 'breaking key',key,'into',key1,',',key2
match1 = subStringMatchExact(target,key1)
match2 = subStringMatchExact(target,key2)
filtered = constrainedMatchPair(match1,match2,len(key1))
allAnswers = allAnswers + filtered
print 'match1',match1
print 'match2',match2
print 'possible matches for',key1,key2,'start at',filtered
return allAnswers
def subStringMatchExactlyOneSub(target,key):
"""Returns tuple of ONLY partial matches"""
partialMatch = []
exactMatch = subStringMatchExact(target,key)
subMatch = subStringMatchOneSub(target,key)
for match in subMatch:
# Check to make sure the value isn't an exact match or already in our list
if match not in exactMatch and match not in partialMatch:
partialMatch.append(match)
return tuple(partialMatch)
matches = subStringMatchExactlyOneSub(target2,key13)
print "The partial only matches are:",matches
No comments. Sign up or log in to comment # File ps3a.py
#===============================================================
def countSubStringMatch(target,key):
""" Count the number of substring returns int """
index = count = 0
while index != -1:
index = target.find(key)
if index >= 0 :
count += 1
target = target[index+len(key):]
return count
def countSubStringMatchRecursive(target,key):
""" Count the number of substring returns int """
index = target.find(key)
if index == -1:
return 0;
else:
return 1 + countSubStringMatchRecursive(target[index+len(key):],key)
#================================================================
# File ps3b.py
#================================================================
def subStringMatchExact(target,key):
""" return the tuple of indices of the exact matches of key in the target"""
index = 0
indexes = ()
if len(key) == 0:
return tuple(range(len(target)))
while index != -1:
index = target.find(key,index)
if index >= 0 :
indexes = indexes + (index,)
index = index + len(key)
return tuple(indexes)
#================================================================
# File ps3c.py
#================================================================
def findSubStringsKey(key):
""" Finds combination of keys """
strings = []
for i in range(len(key)):
t = key[:i],key[i+1:]
strings.append(t)
return strings
def constrainedMatchPair(firstMatch,secondMatch,length):
return tuple(fM for fM in firstMatch for sM in secondMatch if fM + length + 1 == sM)
### the following procedure you will use in Problem 3
def subStringMatchOneSub(key,target):
"""search for all locations of key in target, with one substitution"""
allAnswers = ()
for miss in range(0,len(key)):
# miss picks location for missing element
# key1 and key2 are substrings to match
key1 = key[:miss]
key2 = key[miss+1:]
#print 'breaking key',key,'into',key1, ' : ' , key2
# match1 and match2 are tuples of locations of start of matches
# for each substring in target
match1 = subStringMatchExact(target,key1)
match2 = subStringMatchExact(target,key2)
# when we get here, we have two tuples of start points
# need to filter pairs to decide which are correct
filtered = constrainedMatchPair(match1,match2,len(key1))
if filtered:
allAnswers = allAnswers + filtered
#print 'match1',match1
#print 'match2',match2
#print 'possible matches for',key1,key2,'start at',filtered
return allAnswers
#================================================================
#File ps3d.py
#================================================================
def subStringMatchExactlyOneSub(target,key):
return set(subStringMatchOneSub(key,target)) - set(subStringMatchExact(target,key))
#================================================================
No comments. Sign up or log in to comment def countSubStringMatch(target,key):
count = 0
pos = -1
while True:
pos = target.find(key,pos+1)
if pos >= 0:
count += 1
if pos == -1:
break
return count
def countSubStringMatchRecursive(target,key):
if target.find(key) >=0:
bef,sep,target = target.partition(key)
return 1 + countSubStringMatchRecursive(target,key)
return 0
def subStringMatchExact(target,key):
pos = target.find(key)
allpos = []
allpos.append(pos)
while True:
if pos <= -1:
return tuple(allpos)
pos = target.find(key,pos+1)
if pos >= 0:
allpos.append(pos)
return tuple(allpos)
def constrainedMatchPair(firstMatch, secondMatch, length):
allMembers = []
for i in firstMatch:
for j in secondMatch:
if i + length + 1 == j:
allMembers.append(i)
return tuple(allMembers)
Comments:I like your use of the partition attribute the recursive function; very clean. def countSubStringMatchRecursive(target,key):
if target.find(key) >=0:
bef,sep,target = target.partition(key)
return 1 + countSubStringMatchRecursive(target,key)
return 0
copied from lecture 4's page ps3a.py from string import *
def countSubStringMatch(target, key):
"""counts the number of times 'key' appears in 'target'"""
counter = 0
next = 0
while find(target, key, next) != -1:
next = find(target, key, next) + 1
counter += 1
return counter
def countSubStringMatchRecursive(target, key):
"""counts the number of times 'key' appears in 'target'"""
counter = 0
if find(target, key) != -1:
counter = 1 + countSubStringMatchRecursive(target[find(target, key)+1:], key)
return counter
Comments:ps3b-d.py from string import *
# this is a code file that you can use as a template for submitting your
# solutions
# these are some example strings for use in testing your code
# target strings
target1 = 'atgacatgcacaagtatgcat'
target2 = 'atgaatgcatggatgtaaatgcag'
# key strings
key10 = 'a'
key11 = 'atg'
key12 = 'atgc'
key13 = 'atgca'
### the following procedure you will use in Problem 3
def subStringMatchExact(target,key):
counter = []
next = 0
while find(target, key, next) != -1:
counter += [find(target, key, next)]
next = find(target, key, next) + 1
return tuple(counter)
def constrainedMatchPair(firstMatch, secondMatch, length):
counter = []
for x in firstMatch:
for y in secondMatch:
if x + length + 1 == y:
counter += [x]
return tuple(counter)
def subStringMatchExactlyOneSub(target,key):
exactMatch = subStringMatchExact(target, key)
subMatch = subStringMatchOneSub(key, target)
counter = list(subMatch)
for x in subMatch:
for y in exactMatch:
if x == y:
counter.remove(x)
return tuple(counter)
def subStringMatchOneSub(key,target):
"""search for all locations of key in target, with one substitution"""
allAnswers = ()
for miss in range(0,len(key)):
# miss picks location for missing element
# key1 and key2 are substrings to match
key1 = key[:miss]
key2 = key[miss+1:]
print 'breaking key',key,'into',key1,key2
# match1 and match2 are tuples of locations of start of matches
# for each substring in target
match1 = subStringMatchExact(target,key1)
match2 = subStringMatchExact(target,key2)
# when we get here, we have two tuples of start points
# need to filter pairs to decide which are correct
filtered = constrainedMatchPair(match1,match2,len(key1))
allAnswers = allAnswers + filtered
print 'match1',match1
print 'match2',match2
print 'possible matches for',key1,key2,'start at',filtered
return allAnswers
I tried out your constrainedMatchPair, it's a little different from mine, but seems to work better. Maybe you can help me figure out where mine is wrong. The problem with yours is if I try subStringMatchOneSub("atgc","atgc") I'm still not getting all the answers I want. I've come to the conclusion the problem is we need the size of key2 which we're not given so there's a bug in the given code. I definitely was overthinking this. def constrainedMatchPair(firstMatch,secondMatch,length):
pairList = []
for n in range(0,len(firstMatch)):
for k in range(0,len(secondMatch)):
if n + length + 1 == k:
pairList.append(n)
else:
pass
return tuple(pairList)
I found the problem in mine. I was using range and in the for statements. The use of the variable name "counter" in constrainedMatchPair() and other functions when it is storing a list of matches is a bit confusing for readers. I found this assignment really hard at first. I found it became easier the more closely I read the instructions on the handout (I think I psyched myself out about what the problem required). I did not like my solution to countSubStringMatchRecursive() (problem 1). I'm looking forward to seeing other people's solutions. Also, the professor gave us a program whose parameters were (key, target), but then advised that we make all the other programs (target, key). Did anyone else find this strange? It almost tripped me up at the end. Did anyone just tweak the program we were given to make it follow the convention in the module? #! /usr/bin/env python
# -*- coding: utf8 -*-
# these are some example strings for use in testing your code
# target strings
target1 = 'atgacatgcacaagtatgcat'
target2 = 'atgaatgcatggatgtaaatgcag'
targets = (target1, target2)
# key strings
key10 = 'a'
key11 = 'atg'
key12 = 'atgc'
key13 = 'atgca'
keys = (key10, key11, key12, key13)
### the following procedure you will use in Problem 3
def subStringMatchOneSub(key,target):
"""search for all locations of key in target, with one substitution"""
allAnswers = ()
for miss in range(0,len(key)):
# miss picks location for missing element
# key1 and key2 are substrings to match
key1 = key[:miss]
key2 = key[miss+1:]
##print 'breaking key',key,'into',key1,key2
# match1 and match2 are tuples of locations of start of matches
# for each substring in target
match1 = subStringMatchExact(target,key1)
match2 = subStringMatchExact(target,key2)
# when we get here, we have two tuples of start points
# need to filter pairs to decide which are correct
filtered = constrainedMatchPair(match1,match2,len(key1))
allAnswers = allAnswers + filtered
##print 'match1',match1
##print 'match2',match2
##print 'possible matches for',key1,key2,'start at',filtered
return allAnswers
#######################################################################
## PROBLEM 1
from string import *
def countSubStringMatch(target,key):
counter = [-1]
tryrange = range(0, len(target) + 1)
for x in tryrange:
location = find(target, key, x)
if location not in counter:
counter.append(location)
if counter == -1:
return 0
else:
counter.remove(-1)
return len(counter)
def helpcountSubStringMatchRecursive(target, key, incr, counter):
position = find(target, key, incr)
incr += 1
if position not in counter:
counter.append(position)
helpcountSubStringMatchRecursive(target, key, incr, counter)
if incr -1 >= len(target):
return counter
else:
helpcountSubStringMatchRecursive(target, key, incr, counter)
def countSubStringMatchRecursive(target, key):
counter = [-1]
helpcountSubStringMatchRecursive(target, key, 0, counter)
counter.remove(-1)
return len(counter)
## PROBLEM 2
def subStringMatchExact(target,key):
counter = [-1]
tryrange = range(0, len(target) + 1)
for x in tryrange:
location = find(target, key, x)
if location not in counter:
counter.append(location)
if counter == -1:
return 0
else:
counter.remove(-1)
return tuple(counter)
## PROBLEM 3
def constrainedMatchPair(firstMatch, secondMatch, length):
matches = []
for n in firstMatch:
for k in secondMatch:
m = length
if n + m + 1 == k:
matches.append(n)
return tuple(matches)
## PROBLEM 4
def subStringMatchExactlyOneSub(target,key):
exact = subStringMatchExact(target,key)
close = subStringMatchOneSub(key,target)
onesub = []
for index in close:
if index not in exact:
onesub.append(index)
return tuple(onesub)
##TEST FUNCTION
for target in targets:
for key in keys:
print "\nTarget: ", target
print "Key: ", key
print subStringMatchExactlyOneSub(target, key)
Comments:I've been working on constrainedMatchPair and had the exact smae code as yours. When I put subStringMatchOneSub("atgc","atgc") In the idle, I feel like i should get back 4 possibles matches at 0, but don't get any. I dont think you would need that check for counter if in the list , you are incrementing the index anyways, recursive function can be done better :). Have a look at list comprehensions, generators and sets. Just my two cents. Yeah, i have trouble writing good recursive functions. At least I know my weakness! |
No comments. Sign up or log in to comment