chip


Joined 1 year ago
Homeworks submitted:
Homework comments:
9
0

About Me

No description provided.

Classes

MIT OpenCourseWare 6.00 Introduction to Computer Science and Programming

Class status: Established
Role: Student
. 52% complete

Submitted Assignments

MIT OpenCourseWare 6.00 Introduction to Computer Science and Programming: Lesson 12, HW 1
  1. Complexity of fact0 is O(n), because recursion have fixed nested level that depends on a "n" and works until n != 1.
  2. Complexity of fact1 is O(n), because there only one for loop
  3. If except loop in conditional statement than the complexity equals O(n), because there also one constant loop
  4. O(n), because there are same one constant loop, and makeSet functions execute only in the first time
#5
def swap0([1], [2]): 
        assert type(s1) == list and type(s2) == list #True
        tmp = s1[:]   #[1]
        s1 = s2[:]     #[2]
        s2 = tmp      #[1]
        return
s1 = [1]
s2 = [2]
swap0(s1, s2)        #s1 = 1, s2 = 2
print(s1, s2)          #[1] [2]

#6
def swap1(s1, s2):
    assert type(s1) == list and type(s2) == list #True
    return s2, s1 
s1 = [1] 
s2 = [2] 
s1, s2 = swap1(s1, s2) #s1 = 2, s2 = 1
print(s1, s2) #[2] [1]

#7
def rev([1,2,3]): 
        assert type(s) == list 
            for i in range(0,1):
                tmp = s[i]           #1
                s[i] = s[-(i+1)]    # [3,2,3]
                s[-(i+1)] = tmp   #[3,2,1]
rev(s)
print(s) #[3,2,1]



chip 1 year ago
MIT OpenCourseWare 6.00 Introduction to Computer Science and Programming: Lesson 11, HW 1
# Problem Set 6: Word Game
# Name: chip

import random
import time

VOWELS = 'aeiou'
CONSONANTS = 'bcdfghjklmnpqrstvwxyz'
HAND_SIZE = 7
HAND_LIMIT = 20

SCRABBLE_LETTER_VALUES = {
'a': 1, 'b': 3, 'c': 3, 'd': 2, 'e': 1, 'f': 4, 'g': 2, 'h': 4, 'i': 1, 'j': 8, 'k': 5, 'l': 1, 'm': 3, 'n': 1, 'o': 1, 'p': 3, 'q': 10, 'r': 1, 's': 1, 't': 1, 'u': 1, 'v': 4, 'w': 4, 'x': 8, 'y': 4, 'z': 10
}

WORDLIST_FILENAME = "words.txt"

def get_word_rearrangements(word_list):
    rearrange_dict = []
    for word in word_list:
        rearrange_dict.append("".join(sorted(word)))
    return rearrange_dict

def get_frequency_dict(sequence):
    freq = {}
    for x in sequence:
        freq[x] = freq.get(x, 0) + 1
    return freq

def display_hand(hand):
    for letter in hand.keys():
        for j in range(hand[letter]):
            print(letter)              # print all on the same line

def deal_hand(n):
    hand={}
    num_vowels = n // 3
    for i in range(num_vowels):
        x = VOWELS[random.randrange(0,len(VOWELS))]
        hand[x] = hand.get(x, 0) + 1
    for i in range(num_vowels, n):
        x = CONSONANTS[random.randrange(0,len(CONSONANTS))]
        hand[x] = hand.get(x, 0) + 1
    return hand

def update_hand(hand, word):
    new_hand = hand.copy()
    for c in word:
        if c in new_hand:
            new_hand[c] -= 1;
            if new_hand[c] == 0:
                del new_hand[c]
    return new_hand

def is_valid_word(word, hand, word_list):
    test_hand = hand.copy()
    if word not in word_list:
        return False
    for c in word:
        if c not in test_hand:
            return False
        else:
            if test_hand[c] == 0:
                return False
            test_hand[c] -= 1
    return True

def load_words():
    inFile = open(WORDLIST_FILENAME, encoding='utf-8')
    wordlist = []
    for line in inFile:
        wordlist.append(line.strip().lower())
    return wordlist

def get_word_score(word, n):
    score = 0
    for c in word:
        score += SCRABBLE_LETTER_VALUES[c]
        if len(word) == n:
            score += 50
    return score

def get_words_to_points(word_list):
    points_dict = {}
    for word in word_list:
        points_dict[word] = get_word_score(word,0)
    return points_dict

def pick_best_word(hand, points_dict):
    posibilities = {}    
    for (word, point) in points_dict.items():
        posible_word = True
        hand_copy = hand.copy()
        for ch in word:
            if ch not in hand_copy.keys():
                posible_word = False
                break
            else:
                del hand_copy[ch]
        if posible_word: 
            posibilities[point] = word
    key_vals = posibilities.keys()
    sorted(key_vals)
    if len(posibilities) == 0:
        return "."
    else:
        return posibilities[max(key_vals)]

def pick_best_word_faster(hand, points_dict, rearrange_dict):
    posibilities = {}
    sorted_hand = "".join(sorted("".join(hand)))
    for (word, point) in points_dict.items():        
        if sorted_hand in rearrange_dict:
           posibilities[point] = word
    if len(posibilities) == 0:        
        return "."
    else:
        return posibilities[max(posibilities.keys())]

def play_hand(hand, word_list, rearrange_dict):
    points_dict = get_words_to_points(word_list)
    total_points, time_spend, total_time = 0,0,0
    while True:
        print("Current hand: ")
        display_hand(hand)
        start_time = time.time()
        print("You have " + str(HAND_LIMIT - total_time) + " seconds ramaining!")
        word = pick_best_word_faster(hand, points_dict, rearrange_dict)
#       word = input("Enter word, or . to indicate thar you are finished: ")
        time_spend += (time.time() - start_time)
        total_time += time_spend
        if word == ".":
            print("Total score: ",total_points)
            break
        if total_time > HAND_LIMIT:
            print("Time limit exceeded!")
            break
        if not is_valid_word(word, hand, word_list):
            print("Ivalid word, please try again!")
            continue
        points = get_word_score(word, len(hand))
        print(("It took {0:2f} seconds to provide an answer.").format(time_spend))
        total_points += (points / time_spend)
        print(word, "earned", points,"points. Total:",total_points)
        hand = update_hand(hand, word)
        time_spend = 0

def play_game(word_list, rearrange_dict):
    hand = deal_hand(HAND_SIZE)
    while True:
        cmd = input("Enter n to deal a new hand, r to replay the last hand, or e to end game: ")
        if cmd == "n":
            hand = deal_hand(HAND_SIZE)
            play_hand(hand.copy(), word_list, rearrange_dict)
            print()
        elif cmd == "r":
            play_hand(hand.copy(), word_list, rearrange_dict)
            print()
        elif cmd == "e":
            break
        else:
            print("Invalid command.")

word_list = load_words()
rearrange_dict = get_word_rearrangements(word_list)
play_game(word_list, rearrange_dict)

chip 1 year ago
MIT OpenCourseWare 6.00 Introduction to Computer Science and Programming: Lesson 9, HW 2
#Problem Set 5
#Name: chip

WORDLIST_FILENAME = "words.txt"

def load_words():
	inFile = open(WORDLIST_FILENAME, encoding='utf-8')
	wordlist = []
	for line in inFile:
		wordlist.append(line.strip().lower())
	return wordlist

word_list = load_words()

def make_turn(player, fragment):
	print("Current word fragment:\'",fragment,"\'")
	print(player, "turn")
	letter = input(player + " says letter: ")
	if check_input(letter) != False:
		fragment += letter
		check_fragment(fragment)
	return fragment

def check_input(letter):
	if not letter.isalpha() or len(letter) != 1:
		return False
	return True

def check_fragment(fragment):
	fg = fragment.lower().strip()
	if fg in word_list and len(fg) > 3:
		return fragment + " is a word"
	for word in word_list:
		indx = word.find(fg)
		if indx != -1:
			if indx == 0:
				return True
	return "no words begins with " + fragment;

def play_game():
	players = ["Player 1", "Player 2"]
	player = 0
	fragment = ""
	
	print ("Welcome to Ghost!")
	while True:
		fragment = make_turn(players[player], fragment)
		fragment_check = check_fragment(fragment)
		if fragment_check != True:
			print("Player", players[player],"loses because",fragment_check)
			break
		if player + 1 >= len(players):
			player = 0
		else:
			player += 1
		print("\n")

play_game()

chip 1 year ago
MIT OpenCourseWare 6.00 Introduction to Computer Science and Programming: Lesson 9, HW 1
# Problem Set 5: 6.00 Word Game
# Name: chip

import random

VOWELS = 'aeiou'
CONSONANTS = 'bcdfghjklmnpqrstvwxyz'
HAND_SIZE = 7

SCRABBLE_LETTER_VALUES = {
    'a': 1, 'b': 3, 'c': 3, 'd': 2, 'e': 1, 'f': 4, 'g': 2, 'h': 4, 'i': 1, 'j': 8, 'k': 5, 'l': 1, 'm': 3, 'n': 1, 'o': 1, 'p': 3, 'q': 10, 'r': 1, 's': 1, 't': 1, 'u': 1, 'v': 4, 'w': 4, 'x': 8, 'y': 4, 'z': 10
}

WORDLIST_FILENAME = "words.txt"

def get_frequency_dict(sequence):
	freq = {}
	for x in sequence:
		freq[x] = freq.get(x, 0) + 1
	return freq

def display_hand(hand):
    for letter in hand.keys():
        for j in range(hand[letter]):
            print(letter)              # print all on the same line

def deal_hand(n):
    hand={}
    num_vowels = n // 3

    for i in range(num_vowels):
        x = VOWELS[random.randrange(0,len(VOWELS))]
        hand[x] = hand.get(x, 0) + 1

    for i in range(num_vowels, n):
        x = CONSONANTS[random.randrange(0,len(CONSONANTS))]
        hand[x] = hand.get(x, 0) + 1
		
    return hand

def update_hand(hand, word):
	new_hand = hand.copy()
	for c in word:
		if c in new_hand:
			new_hand[c] -= 1;
			if new_hand[c] == 0:
				del new_hand[c]
	return new_hand

def is_valid_word(word, hand, word_list):
	test_hand = hand.copy()
	if word not in word_list:
		return False
	for c in word:
		if c not in test_hand:
			return False
		else:
			if test_hand[c] == 0:
				return False
			test_hand[c] -= 1
	return True

def load_words():
	inFile = open(WORDLIST_FILENAME, encoding='utf-8')
	wordlist = []
	for line in inFile:
		wordlist.append(line.strip().lower())
	return wordlist

def get_word_score(word, n):
	if word in word_list:
		score = 0
		for c in word:
			score += SCRABBLE_LETTER_VALUES[c]
		if len(word) == n:
			score += 50
		return score
	else:
		return 0

def play_hand(hand, word_list):
	total_points = 0
	while True:
		print("Current hand: ")
		display_hand(hand)
		word = input("Enter word, or . to indicate thar you are finished: ")
		if word == ".":
			print("Total score: ",total_points)
			break
		if not is_valid_word(word, hand, word_list):
			print("Ivalid word, please try again!")
			continue
		points = get_word_score(word, len(hand))
		total_points += points
		print(word, "earned", points,"points. Total:",total_points)
		hand = update_hand(hand, word)

def play_game(word_list):
	hand = deal_hand(HAND_SIZE)
	while True:
		cmd = input("Enter n to deal a new hand, r to replay the last hand, or e to end game: ")
		if cmd == "n":
			hand = deal_hand(HAND_SIZE)
			play_hand(hand.copy(), word_list)
			print()
		elif cmd == "r":
			play_hand(hand.copy(), word_list)
			print()
		elif cmd == "e":
			break
		else:
			print("Invalid command.")

word_list = load_words()
play_game(word_list)

chip 1 year ago
MIT OpenCourseWare 6.00 Introduction to Computer Science and Programming: Lesson 7, HW 1
# Problem Set 4
# Name: chip
# Time: 0:45

#
# Problem 1
#

def nestEggFixed(salary, save, growthRate, years):
    assert type(years) == type(1) and years > 0, "Years must integer and > 0"
    retirement = [salary * save * 0.01]
    startyear = 1
    while startyear < years:
            retirement.append(retirement[-1] * (1 + 0.01 * growthRate) + salary * save * 0.01)
            startyear += 1
    return retirement 

#
# Problem 2
#

def nestEggVariable(salary, save, growthRates):
    retitement = [salary * save * 0.01]
    del growthRates[0]
    for rate in growthRates:
        retitement.append(retitement[-1] * (1 + 0.01 * rate) + salary * save * 0.01)
    return retitement

#
# Problem 3
#

def postRetirement(savings, growthRates, expenses):
    retitement = [savings * (1 + 0.01 * growthRates[0]) - expenses]
    i = 1
    while i < len(growthRates):
        retitement.append(retitement[-1] * (1 + 0.01 * growthRates[i]) - expenses)
        i += 1
    return retitement

#
# Problem 4
#

def findMaxExpenses(salary, save, preRetireGrowthRates, postRetireGrowthRates, epsilon):
    years = len(preRetireGrowthRates)
    savings = nestEggVariable(salary, save, preRetireGrowthRates)[years - 1]
    low = 0
    height = savings
    gues = (height + low) / 2
    rest = postRetirement(savings, postRetireGrowthRates, gues)[years - 1]
    while abs(rest) > epsilon:
        if rest > 0:
            low = gues
        else:
            height = gues
        gues = (height + low) / 2
        rest = postRetirement(savings, postRetireGrowthRates, gues)[years - 1]
    return gues

def testNestEggFixed():
    salary     = 10000
    save       = 10
    growthRate = 15
    years      = 5
    savingsRecord = nestEggFixed(salary, save, growthRate, years)
    print savingsRecord
    # Output should have values close to:
    # [1000.0, 2150.0, 3472.5, 4993.375, 6742.3812499999995]

def testNestEggVariable():
    salary      = 10000
    save        = 10
    growthRates = [3, 4, 5, 0, 3]
    savingsRecord = nestEggVariable(salary, save, growthRates)
    print savingsRecord
    # Output should have values close to:
    # [1000.0, 2040.0, 3142.0, 4142.0, 5266.2600000000002]

def testPostRetirement():
    savings     = 100000
    growthRates = [10, 5, 0, 5, 1]
    expenses    = 30000
    savingsRecord = postRetirement(savings, growthRates, expenses)
    print savingsRecord
    # Output should have values close to:
    # [80000.000000000015, 54000.000000000015, 24000.000000000015,
    # -4799.9999999999854, -34847.999999999985]

def testFindMaxExpenses():
    salary                = 10000
    save                  = 10
    preRetireGrowthRates  = [3, 4, 5, 0, 3]
    postRetireGrowthRates = [10, 5, 0, 5, 1]
    epsilon               = .01
    expenses = findMaxExpenses(salary, save, preRetireGrowthRates,
                               postRetireGrowthRates, epsilon)
    print expenses
    # Output should have a value close to:
    # 1229.95548986

testNestEggFixed()
testNestEggVariable()
testPostRetirement()
testFindMaxExpenses()

chip 1 year ago
MIT OpenCourseWare 6.00 Introduction to Computer Science and Programming: Lesson 5, HW 1
#Problem Set 3
#Name: chip
#Time: 0:40


target1 = 'atgacatgcacaagtatgcat'
target2 = 'atgaatgcatggatgtaaatgcag'

key10 = 'a'
key11 = 'atg'
key12 = 'atgc'
key13 = 'atgca'

#Problem 1
def countSubStringMatch(target, key):
        result = target.find(key)
        count = 0
        while result != -1:
                count += 1
                result = target.find(key, result + 1)
        return count

def countSubStringMatchRecursive(target, key):
        result = target.find(key)
        if result == -1:
                return 0;
        else:
                return 1 + countSubStringMatchRecursive(target[result+len(key):], key)

#Problem 2
def subStringMatchExact(target,key):
        result = target.find(key)
        index = ()
        while result != -1:
                index += (result,)
                result = target.find(key, result + 1)
        return index

#Problem 3
def constrainedMatchPair(firstMatch, secondMatch, length):
        matches = ()
        for n in firstMatch:
                k = n + length + 1
                if k in secondMatch:
                        matches += (n,)
        return matches

def subStringMatchOneSub(key,target):
    """search for all locations of key in target, with one substitution"""
    allAnswers = ()
    for miss in range(0,len(key)):
        # miss picks location for missing element
        # key1 and key2 are substrings to match
        key1 = key[:miss]
        key2 = key[miss+1:]
        print('breaking key',key,'into',key1,key2)
        # match1 and match2 are tuples of locations of start of matches
        # for each substring in target
        match1 = subStringMatchExact(target,key1)
        match2 = subStringMatchExact(target,key2)
        # when we get here, we have two tuples of start points
        # need to filter pairs to decide which are correct
        filtered = constrainedMatchPair(match1,match2,len(key1))
        allAnswers = allAnswers + filtered
        print('match1',match1)
        print('match2',match2)
        print('possible matches for',key1,key2,'start at',filtered)
    return allAnswers

#Problem 4

def subStringMatchExactlyOneSub(target, key):
        return tuple(set(subStringMatchOneSub(key, target)) - set(subStringMatchExact(target, key)))

chip 1 year ago
MIT OpenCourseWare 6.00 Introduction to Computer Science and Programming: Lesson 3, HW 1
#Problem Set 2
#Name: chip
#Time: 4:00
#

#Problem 1
region = range(50, 55)

for a in range (0, 20):
	for b in range(0,20):
		for c in range(0,20):
			k = 6 * a + 9 * b + 20 * c;
			if k in region:
				print("{0:2}*6 + {1}*9 + {2}*20 = {3}".format(a,b,c,k));

#	2*6 + 2*9 + 1*20 = 50
#	5*6 + 1*9 + 0*20 = 51
#	2*6 + 0*9 + 2*20 = 52
#	1*6 + 3*9 + 1*20 = 53	
#	9*6 + 0*9 + 0*20 = 54
#	1*6 + 1*9 + 2*20 = 55

#Problem 2
"""
	Theorem is true because when we had all x, x+1,..., x+5 all next steps will repeat.
	For example if we has 54 nugets we can add 6 and get 60 or 51 + 6 =57.
	This works for any x, ...,  x+5 values
"""

#Problem 3
def can_buy(n, ax, bx, cx):
	for a in range(0,20):
		for b in range(0,20):
			for c in range(0,20):
				k = ax * a + bx * b + cx * c
				if k == n:
					return True
	return False

def solve(a,b,c):
	count = 0
	for n in range(1,200):
		if not can_buy(n,a,b,c):
			ans = n
			count = 0
		else:	count += 1
		if count == 6:	break
	print("Given package sizes <{0}>, <{1}>, <{2}>, the largest number of McNuggets that cannot be bought in exact quantity is: {3}".format(a,b,c,ans))


solve(6,9,20)

#Problem 4
solve(10,14,15)

chip 1 year ago
MIT OpenCourseWare 6.00 Introduction to Computer Science and Programming: Lesson 2, HW 1
#Problem Set 1
#Name: chip


import math

N = 1000
log_sum = math.log(2) 

print(2)
for counter in range(3, N, 2):
	prime = True 
	for j in range(3, N - 1, 2):
		if counter % j == 0 and counter != j:
			prime = False
			break
	if prime:
		log_sum += math.log(counter)
		print(counter)
	counter += 2;	

print("Sum of logs is: ", log_sum)
print("N equals to: ", N)
print("Ration is: ", log_sum / N)

chip 1 year ago
MIT OpenCourseWare 6.00 Introduction to Computer Science and Programming: Lesson 1, HW 1

Problem Set 0, using python3 evn

#Problem Set 0

user_lastname =  input("Enter your last name:")
user_firstname = input("Enter your first name:")
print(user_firstname, user_lastname)

chip 1 year ago